Informacja

Polimeraza RNA i helikaza DNA

Polimeraza RNA i helikaza DNA



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Czy helikaza DNA lub polimeraza RNA są odpowiedzialne za zerwanie wiązania wodorowego między 2 nićmi podczas transkrypcji dla komórek eukariotycznych? Mój podręcznik (WJEC Biology for AS level) mówi, że to helikaza DNA zrywa wiązania wodorowe, podczas gdy polimeraza RNA katalizuje tworzenie wiązań między nukleotydami RNA.

Enzym helikaza DNA zrywa wiązania wodorowe między zasadami w określonym regionie cząsteczki DNA. To powoduje, że dwie nici rozdzielają się i rozwijają, odsłaniając zasady nukleotydowe. Enzym polimeraza RNA wiąże się z nicią matrycową DNA na początku sekwencji do skopiowania.

Jednak gdy szukałem w Internecie, na przykład na https://en.wikiversity.org/wiki/Effect_of_hydrogen_bond_on_RNA

Transkrypcję można łatwo wyjaśnić w 4 lub 5 prostych krokach, z których każdy porusza się jak fala wzdłuż DNA. Polimeraza RNA rozwija/"rozpina" DNA poprzez zerwanie wiązań wodorowych między komplementarnymi nukleotydami. Nukleotydy RNA są sparowane z komplementarnymi zasadami DNA. Szkielet cukrowo-fosforanowy RNA tworzy się z pomocą polimerazy RNA.

Czy polimeraza RNA zrywa wiązania wodorowe? Jeśli polimeraza RNA może zrywać wiązania wodorowe między nićmi, to jaka jest rola helikazy DNA w procesie transkrypcji?


Zastrzeżenie

Jak wskazałem w swoim komentarzu, nie jest jasne, czy wspomniane źródła odnoszą się do eukariontów czy prokariontów, zakładając, że są poprawne. Jestem raczej tłumaczem, a nie transkrypcją, więc odpowiadam na to z wydania Berg . z 2002 r i in. „Biochemia”, bo tak się składa, że ​​mam własną kopię (darmową z czasów, kiedy jeszcze uczyłam) i ta edycja jest dostępna bezpłatnie online. Zachęcamy członków listy z większą wiedzą w tej dziedzinie do publikowania komentarzy w celu poprawienia błędów w mojej odpowiedzi lub dostarczania aktualizacji.

Odpowiedź

  1. w ani prokariota, ani eukariota jest helikazą DNA, która działa podczas replikacji DNA zaangażowanej w transkrypcję, chociaż inne białka niezbędne do transkrypcji mają aktywność helikazy DNA.

  2. w prokariota wydaje się, że holoenzym polimerazy RNA (składający się z zaledwie czterech podjednostek) jest odpowiedzialny za rozwinięcie około 17 par zasad matrycowego DNA. Cytując z rozdziału 28.1.3:

    Każda związana cząsteczka polimerazy rozwija 17-pz segment DNA, co odpowiada 1,6 zwojom helisy B-DNA

    Może istnieć pewna niejasność spowodowana opisem sposobu wyznaczenia tej wartości eksperymentalnie, ponieważ obejmowała ona dodanie topoizomerazy II. Jednak z dyskusji w innym miejscu jasno wynika, że ​​jest to enzym replikacji DNA i nie jest zaangażowany w transkrypcję.

  3. w eukarionty Transkrypcja jest znacznie bardziej złożona i obejmuje oddzielne polimerazy dla różnych klas produktów RNA oraz różnorodne pomocnicze czynniki transkrypcyjne w przypadku polimerazy RNA II, która transkrybuje mRNA. Zgodnie z sekcją 28.2.4:

    Skrzynka TATA DNA wiąże się z wklęsłą powierzchnią TBP [białka wiążącego skrzynkę TATA]. Wiązanie to indukuje duże zmiany konformacyjne w związanym DNA. Podwójna helisa jest zasadniczo rozwinięta, aby poszerzyć swój mniejszy rowek, umożliwiając jej rozległy kontakt z antyrównoległymi nićmi β po wklęsłej stronie TBP.

    Tak więc wstępne rozpoznanie skrzynki TATA powoduje pewne odprężenie. Jednak głównym graczem wydaje się być czynnik transkrypcyjny TFIIF:

    helikazy zależnej od ATP, która początkowo oddziela dupleks DNA dla polimerazy


Polimeraza RNA lub helikaza DNA. I ekspresja genów.

Tak więc podczas transkrypcji w jądrze nić DNA jest „rozpakowywana”, dzięki czemu sekwencja komplementarnych zasad może zostać skopiowana, a mRNA wyjęte z jądra na rybosom. Czy to helikaza DNA rozrywa wiązania wodorowe w DNA, czy jest to polimeraza RNA? Myślałem, że to helikaza DNA rozrywa wiązania wodorowe lub rozpina się, a polimeraza RNA zbiera wszystkie składniki, aby utworzyć nić mRNA. Czy to prawda i proszę popraw wszystko, co się pomyliło.

RÓWNIEŻ, jaka jest różnica między genem operatora a regionem promotora? Czy to jest tak: cząsteczka represora przyłącza się do genu operatora, aby zapobiec wiązaniu polimerazy RNA, ale jeśli cząsteczka represora jest nieobecna, region promotora jest miejscem, w którym polimeraza RNA będzie się wiązać? Ponownie proszę popraw wszystko, co jest nie tak, to mnie trochę myli

Dziękuję Ci

Nie to, czego szukasz? Wypróbuj&hellip

(Oryginalny post autorstwa kocham owoce)
Tak więc podczas transkrypcji w jądrze nić DNA jest „rozpakowywana”, dzięki czemu sekwencja komplementarnych zasad może zostać skopiowana, a mRNA wyjęte z jądra na rybosom. Czy to helikaza DNA rozrywa wiązania wodorowe w DNA, czy jest to polimeraza RNA? Myślałem, że to helikaza DNA rozrywa wiązania wodorowe lub rozpina się, a polimeraza RNA zbiera wszystkie składniki, aby utworzyć nić mRNA. Czy to prawda i proszę popraw wszystko, co się pomyliło.

RÓWNIEŻ, jaka jest różnica między genem operatora a regionem promotora? Czy to jest tak: cząsteczka represora przyłącza się do genu operatora, aby zapobiec wiązaniu polimerazy RNA, ale jeśli cząsteczka represora jest nieobecna, region promotora jest miejscem, w którym polimeraza RNA będzie się wiązać? Ponownie proszę popraw wszystko, co jest nie tak, to mnie trochę myli

Dziękuję Ci


Ekspresja genów: transkrypcja kodu genetycznego

Transkrypcja ukierunkowana na polimerazę RNA I i III

Eukariotyczne polimerazy RNA I i III opierają się na odrębnym zestawie białek do inicjowania transkrypcji. Chociaż obie polimerazy RNA I i III mają kilka identycznych podjednostek enzymu rdzeniowego z polimerazą RNA II, rozpoznają bardzo różne sekwencje promotorowe i mają unikalne ogólne czynniki transkrypcyjne. Promotory rozpoznawane przez polimerazę RNA I nie są dobrze konserwowane w sekwencji z jednego gatunku do drugiego. Jednak wszystkie mają podobną ogólną architekturę promotora, ponieważ składają się z elementu rdzenia otaczającego miejsce startu transkrypcji i elementu promotora znajdującego się w górę, który znajduje się około 100 bp dalej w górę. Polimeraza RNA I, która dokonuje transkrypcji genów rRNA, wiąże się z promotorem zawierającym podstawowy element promotora i element kontrolny poprzedzający (UCE). TBP, który jest częścią większego kompleksu zwanego SL1, pomaga polimerazie RNA I rozpoznać główny promotor (ryc. 3.22). Klasyczne promotory polimerazy RNA III to Typ I i ​​Typ II, które mają promotory, które znajdują się całkowicie w genach. Te geny Typu I i Typu II obejmują różne geny RNA, takie jak tRNA, podjednostka 5S RNA rybosomu i geny VA RNA adenowirusa (ryc. 3.23). Promotory polimerazy RNA typu III typu III są nieklasyczne i przypominają te z genów klasy II, w tym gen snRNA U6, gen 7SL RNA i gen 7SK RNA.

Rys. 3.22. Promotory RNA pol I zawierają region rdzeniowy, a także element kontrolny w górę (UCE), który oddziałuje z czynnikami transkrypcyjnymi, takimi jak UBF i SL1 u ludzi.

Rys. 3.23. Przykłady promotorów polimerazy RNA III. Czerwone prostokąty oznaczają promotory genów 5S rRNA, tRNA i U6 snRNA. DSE reprezentuje dalszy element sekwencji, PSE reprezentuje proksymalny element sekwencji.


Nowe badania ujawniają, że komórki ssaków mogą przekształcać segmenty RNA z powrotem w DNA

Zespół naukowców z Thomas Jefferson University w Filadelfii, University of Southern California, Beckman Research Institute of the City of Hope oraz New York University School of Medicine dostarczył pierwszych dowodów na to, że sekwencje RNA można wpisać z powrotem do DNA. wyczyn częściej spotykany u wirusów niż w komórkach eukariotycznych.

Trójczłonowa struktura Polθ na matrycy startera DNA/RNA: (A) Polimeraza Polθ (B) Wydłużenie DNA/RNA przez Polθ i PolθΔL (C) struktura Polθ:DNA/RNA:ddGTP (D) superpozycja Polθ:DNA/ RNA (morski) i Polθ:DNA/DNA (pomarańczowy, 4x0q) subdomeny palców i kciuka przechodzą rekonfigurację (E) superpozycja Polθ:DNA/RNA (morska) i Polθ:DNA/DNA (pomarańczowa, 4x0q) podkreślając 12- Przesunięcie Å K2181 (kciuk niebieskiej skrzynki) i przesunięcie 4,4 Å E2246 (dłoń szarej skrzynki) (F) superpozycja kwasów nukleinowych i ddGTP ze struktur Polθ:DNA/RNA:ddGTP i Polθ:DNA/DNA:ddGTP (G ) góra: gęstość elektronowa ddGTP i 3′ koniec startera w strukturze Polθ:DNA/RNA dół: powiększony obraz superpozycji miejsc aktywnych, ilustrujący inną konformację ddGTP w Polθ:DNA/RNA (niebieski) i Polθ :DNA/DNA (łososiowe) kompleksy (H) oddziaływania pomiędzy rybozowymi grupami 2'-hydroksylowymi matrycy RNA a resztami w strukturze Polθ:DNA/RNA czerwone przerywane linie, wiązania wodorowe (I) DNA/RNA użyte do kokrystalizacji z Polθ i ddGTP (góra) występuje silna gęstość elektronowa dla czterech par zasad [nukleotydy znajdujące się w pozycjach 2 do 5 (podkreślone) DNA/RNA] oraz dwóch par zasad wynikających z inkorporowanego ddGMP (2',3' dideoksyguanozynomonofosforanu ) (zielona pozycja 1) i związany niewłączony ddGTP (czerwona pozycja 0) w miejscu aktywnym (u góry) oddziaływania między Polθ i kwasami nukleinowymi w oddziaływaniach Polθ:DNA/RNA:ddGTP (na dole) między resztami a szkieletem fosforanowym, tlenem cukrowym, lub nukleozasadę pokazano odpowiednio na niebiesko, żółto i zielono, wskazano wiązania wodorowe między grupami Polθ i rybozy 2'-hydroksylowe (reszty w ramce) (J) oddziaływania między Polθ a kwasami nukleinowymi w Polθ:DNA/DNA:ddGTP (4x0q) schemat kolorów identyczny z (I). Źródło obrazu: Chandramouly i inni., doi: 10.1126/sciadv.abf1771.

„Rzeczywistość, że ludzka polimeraza może to zrobić z wysoką wydajnością, rodzi wiele pytań”.

„Na przykład to odkrycie sugeruje, że wiadomości RNA można wykorzystać jako szablony do naprawy lub ponownego pisania genomowego DNA”.

W swoich badaniach dr Pomerantz i współpracownicy skupili się na bardzo niezwykłej polimerazie zwanej polimerazą teta (Polθ).

Spośród 14 polimeraz DNA w komórkach ssaków tylko trzy wykonują większość pracy polegającej na powielaniu całego genomu w celu przygotowania do podziału komórki.

Pozostałe 11 jest głównie zaangażowanych w wykrywanie i naprawę w przypadku pęknięcia lub błędu w niciach DNA.

Polθ naprawia DNA, ale jest bardzo podatna na błędy i popełnia wiele błędów lub mutacji.

Naukowcy zauważyli, że niektóre cechy Polθ to cechy, które dzieli z inną maszyną komórkową, aczkolwiek bardziej powszechną w wirusach - odwrotną transkryptazą.

Podobnie jak Polθ, odwrotna transkryptaza HIV działa jak polimeraza DNA, ale może również wiązać RNA i odczytywać RNA z powrotem do nici DNA.

W serii eksperymentów autorzy przetestowali Polθ na odwrotną transkryptazę wirusa HIV, która jest jedną z najlepiej zbadanych tego typu.

Wykazali, że Polθ jest zdolna do przekształcania wiadomości RNA w DNA, co robiła, podobnie jak odwrotna transkryptaza HIV, i że faktycznie wykonała lepszą pracę niż przy duplikowaniu DNA do DNA.

Polθ była bardziej wydajna i wprowadziła mniej błędów podczas używania szablonu RNA do pisania nowych wiadomości DNA, niż podczas duplikowania DNA w DNA, co sugeruje, że ta funkcja może być jej głównym celem w komórce.

Korzystając z krystalografii rentgenowskiej, zespół odkrył, że ta cząsteczka była w stanie zmienić kształt, aby pomieścić bardziej masywną cząsteczkę RNA – wyczyn wyjątkowy wśród polimeraz.

„Nasze badania sugerują, że główną funkcją Polθ jest działanie jako odwrotna transkryptaza” – powiedział dr Pomerantz.

„W zdrowych komórkach celem tej cząsteczki może być naprawa DNA za pośrednictwem RNA”.

„W niezdrowych komórkach, takich jak komórki rakowe, Polθ jest silnie eksprymowany i promuje wzrost komórek rakowych oraz lekooporność”.

„Bardzo ekscytujące będzie dalsze zrozumienie, w jaki sposób aktywność Polθ na RNA przyczynia się do naprawy DNA i proliferacji komórek rakowych”.


MATERIAŁY I METODY

Testy wydłużania starter-szablon

Względna prędkość aktywności RT (ryc. 1B). Polθ (0,5 nM), HIV RT i Polη (rdzeń katalityczny, reszty od 1 do 514) inkubowano z 10 nM znakowaną izotopowo matrycą DNA/RNA (RP559/RP493R) przez wskazany czas w buforze A [25 mM tris-HCl (pH 7,8), 10 mM MgCl220,01% (obj./obj.) NP-40, 1 mM ditiotreitol (DTT), albumina surowicy bydlęcej (BSA 0,1 mg/ml) i 10% (obj./obj.) glicerol] ze 100 μM dNTPs w 37°C. Procent wydłużenia określono dzieląc intensywność produktu o przedłużonym działaniu przez intensywność sumy produktów rozszerzonych i nierozszerzonych dla każdego toru. Wszystkie reakcje starter-matryca zakończono 25 mM EDTA i 45% (obj./obj.) formamidem, a następnie rozdzielono w żelach poliakrylamidowych denaturujących mocznik i wizualizowano za pomocą PhosphorImager. Szybkość aktywności RT określono na podstawie nachylenia liniowej części wykresu reprezentującej warunki stanu stacjonarnego.

Porównanie aktywności polimerazy na DNA/DNA i DNA/RNA (ryc. 1, D do G). Testy wydłużania starterów na matrycach DNA/RNA (RP559/RP493R) i DNA/DNA (RP559/RP493D) przeprowadzono stosując warunki przedstawione na Fig. 1B z następującymi zmianami. Zastosowano wskazane stężenia wskazanych polimeraz i reakcje prowadzono przez 32 min.

Względna aktywność RT (ryc. 1H). Wskazane polimerazy inkubowano z 10 nM znakowaną radioaktywnie matrycą DNA/RNA (SM98/SM44R) przez 20 min w obecności 10 µM dNTPs w 37°C. Reakcje Polθ i HIV RT przeprowadzono w 25 mM tris-HCl (pH 8,0), 10 mM KCl, 10 mM MgCl20,01% (obj./obj.) NP-40, 1 mM DTT, BSA (0,1 mg/ml) i 10% (obj./obj.) glicerol. Reakcje zawierające AMV RT (20 jednostek, New England Biolabs) przeprowadzono w buforze [50 mM tris-octan (pH 8,3), 75 mM octan potasu, 8 mM octan magnezu i 10 mM DTT] i zawierał BSA (0,1 mg/ ml). Reakcje zawierające M-MuLV RT (400 jednostek, New England Biolabs) przeprowadzono w buforze [50 mM tris-HCl (pH 8,3), 75 mM KCl, 3 mM MgCl2i 10 mM DTT] i zawierał BSA (0,01 mg/ml).

Porównanie aktywności syntezy DNA zależnej od RT i DNA przez skrócone i pełnej długości Polθ (ryc. 1J). Sto nanomolowych wskazanych polimeraz inkubowano z 10 nM znakowanym radioaktywnie DNA/RNA (SM98/SM44R) lub DNA/DNA (SM98/SM44) przez 45 min z 50 μM dNTP i 25 mM tris-HCl (pH 7,8), 2 mM MgCl2, 4 mM KCl, 6 mM NaCl, 0,01% (obj./obj.) NP-40, 1 mM DTT, BSA (0,1 mg/ml), 10% (obj./obj.) glicerol i 750 μM trifosforan adenozyny (ATP) przy 37°C.

Względna szybkość inkorporacji pojedynczego dNMP do znakowanego radioaktywnie DNA/RNA (ryc. 2, od A do E). Polθ (2 nM) inkubowano ze 100 nM wskazanych znakowanych radioaktywnie matryc DNA/RNA i DNA/DNA przez wskazany czas z 300 µM wskazanego dNTP w buforze [25 mM tris-HCl (pH 8,0), 10 mM MgCl2, 4 mM KCI, 6 mM NaCI, 0,01% NP-40, 1 mM DTT, BSA (0,01 mg/ml) i 10% (obj./obj.) glicerol] w 37°C. Wydłużenie procentowe określono jak opisano powyżej.

Względna prędkość nieprawidłowego włączania nukleotydów (dNMP) (ryc. 2, F do J). Polθ (20 nM) inkubowano ze 100 nM wskazanych radioznakowanych matryc DNA/RNA i DNA/DNA oraz 300 µM wskazanego dNTP przez wskazany czas w buforze [25 mM tris-HCl (pH 8,0), 10 mM MgCl2, 10 mM KCl, 0,01% (obj./obj.) NP-40, 1 mM DTT, BSA (0,1 mg/ml) i 10% (obj./obj.) glicerol]. Procent wydłużenia określono jak opisano powyżej. Wszystkie oligonukleotydy znakowano radioaktywnie przy użyciu kinazy polinukleotydowej T4 (New England Biolabs) i 32P-γ-ATP (PerkinElmer) w zalecanym buforze przez 37°C przez co najmniej 1 godzinę.

Test komórkowy MMEJ

Niektóre z zastosowanych tutaj metod są podobne do tych w wcześniej opublikowanym artykule (38). iPSC (2 x 105) transfekowano w zawiesinie 0,25 μg każdego ze wskazanych lewostronnych i prawoskrzydłych konstruktów GFP DNA przy użyciu Lipofectamine 2000 (Invitrogen). Jako kontrolę negatywną do transfekcji w dołkach kontrolnych zastosowano podobną objętość buforu, jaka była używana w dołkach doświadczalnych. Jako kontrolę pozytywną do pomiaru wydajności transfekcji, jednocześnie transfekowano liniowy konstrukt ekspresyjny DNA GFP typu dzikiego. Częstości komórek GFP-dodatnich mierzono 3 dni po transfekcji za pomocą cytometrii przepływowej przy użyciu GUAVA easyCyte 5-HT (Luminex Corp.) w niezależnych powtórzeniach i korygowano pod kątem wydajności transfekcji i zdarzeń tła. Dane są reprezentowane jako średnia i SEM z trzech niezależnych eksperymentów, z co najmniej duplikatami na eksperyment. Analiza statystyczna została przeprowadzona przez sparowane T test.

Przygotowanie konstrukcji reporterowych GFP MMEJ

Niektóre z zastosowanych tu metod są podobne do tych w wcześniej opublikowanym artykule (38). Przygotowanie reakcji łańcuchowej polimerazy (PCR) przebiegało zgodnie z zalecanymi warunkami dla polimerazy DNA Phusion High-Fidelity (New England Biolabs M0530) przy użyciu 10 ng plazmidu pCMV-GFP jako matrycy w buforze 1x Phusion HF. PCR dla DNA z lewej flanki przeprowadzono ze starterami RP500B i RP501. PCR dla DNA z prawej flanki przeprowadzono ze starterami RP502 i RP503B. Po reakcji PCR, produkty DNA z lewej lub prawej flanki połączono razem i strawiono Dpn I (New England Biolabs) w buforze 1x CutSmart, a następnie oczyszczono za pomocą zestawu Qiagen QIAquick PCR Purification Kit. Następnie PCR skoniugowano ze streptawidyną stosując PCR (110 ng/μl) i streptawidynę (0,8 μg/μl) w 10 mM tris-HCl (pH 7,5) i 100 mM NaCl w 37°C przez 1 godzinę. PCR dla DNA z lewej flanki z pięcioma kolejnymi rybonukleotydami przeprowadzono ze starterami RP500B i RP501. PCR oczyszczono, a następnie strawiono Dpn I (New England Biolabs) i Sap I w buforze 1x CutSmart. PCR oczyszczono ponownie, a następnie poddano ligacji z dwuniciowym DNA złożonym ze zhybrydyzowanych oligonukleotydów RP550R-P i RP530a [oligos poddano hybrydyzacji w obecności inhibitora rybonukleazy (RNazy)] przez 16 godzin w 16°C z ligazą DNA T4 (New England Biolabs) w 1x buforze ligazy DNA T4. Ligowany PCR oczyszczono, a następnie skoniugowano ze streptawidyną, jak opisano powyżej. PCR dla DNA lewej flanki z 10 kolejnymi rybonukleotydami przygotowano według tej samej metodologii z ligacją do dwuniciowego DNA złożonego z oligonukleotydów RP546P i RP530. Sprzęganie streptawidyny i etapy amplifikacji DNA potwierdzono w żelach agarozowych barwionych bromkiem etydyny.

Test reporterowy CRISPR-Cas9 knock-in GFP

Rodzicielska U2OS i POLQ e16m linie komórkowe z plazmidami 7-reporterowymi i CAS9/pojedynczym przewodnikiem RNA (sgRNA) w celu ukierunkowania na DSB w tym reporterze, matryca oligonukleotydu DNA i oligonukleotyd kontrolny (LUC) zostały wcześniej opisane (36). Oligonukleotyd R2 ma taką samą sekwencję jak oligonukleotydy DNA, ale z brakiem dwóch zasad RNA w 7-nt w 7-reporterze (IDT). Linie komórkowe wysiano 1 x 105 na płytce 12-dołkowej i transfekowano następnego dnia, a % GFP analizowano 3 dni po transfekcji przy użyciu cytometru CyAN-ADP (DAKO) i znormalizowano do wydajności transfekcji, jak opisano wcześniej (36). Transfekcje do testu reporterowego zawierały 400 ng każdego plazmidu CAS9/sgRNA, 10 pmol oligonukleotydu i 100 ng pCAGGS-BSKX (pusty wektor) lub wektora ekspresyjnego FLAG-POLQ (38). Transfekcje pod kątem wydajności transfekcji zawierały 400 ng pCAGGS-NZE-GFP (wektor ekspresyjny GFP), 500 ng pustego wektora (EV) i 10 pmol oligonukleotydu kontrolnego (36). Transfekcje przeprowadzono za pomocą 4 μl Lipofectamine 2000 (Thermo Fisher Scientific) w 0,2 ml Optimem (Thermo Fisher Scientific) i inkubowano z komórkami w 1 ml podłoża bez antybiotyków przez 4 godziny. Analiza immunoblottingu dla FLAG-POLQ obejmowała ekstrakcję ELB [250 mM NaCl, 5 mM EDTA, 50 mM Hepes, 0,1% (v/v) Ipegal i inhibitor proteazy Roche] z sonikacją (Qsonica, Q800R) i przy użyciu przeciwciał przeciwko FLAG ( Sigma-Aldrich, A8592) lub ACTIN (Sigma-Aldrich, A2066). Analiza sekwencji testu reporterowego z oligonukleotydem R2: Komórki transfekowano jak w teście reporterowym z matrycą oligonukleotydu R2 w POLQ e16m komórki z wektorem ekspresyjnym POLQ, komórki GFP+ izolowano przez sortowanie komórek aktywowane fluorescencyjnie (FACS) (Becton Dickinson Aria Sorter), a produkt naprawy GFP amplifikowano za pomocą CMVFWDFRT5 5′CGCAATGGGCGGTAGGCGTG i BGHREVFRT5 5′TAGAAGGCACAGTCGAGG i sekwencjonowano za pomocą CMVFWDFRT5 Elementarz.

Synteza cDNA

Reakcje syntezy cDNA przeprowadzono za pomocą wskazanej polimerazy w obecności 100 μM dNTPs i optymalnego buforu dla każdego enzymu: Polθ [25 mM tris-HCl (pH 8,0), 10 mM KCl, 10 mM MgCl20,01% (v/v) NP-40, 1 mM DTT, BSA (0,1 mg/ml) i 10% (v/v) glicerol] AMV RT [50 mM tris-octan (pH 8,3), 75 mM potasu octan, 8 mM octan magnezu, 10 mM DTT i BSA (0,1 mg/ml)] i M-MuLV RT [50 mM tris-HCl (pH 8,3), 75 mM KCl, 3 mM MgCl2i 10 mM DTT]. Reakcje z syntetycznym DNA/RNA zawierały 10 ng matrycy. Polθ (100 nM), AMV-RT (20 jednostek) lub M-MuLV RT (400 jednostek) inkubowano w 37°C (Polθ) lub 42°C (AMV-RT i M-MuLV RT) przez 1 godzinę. Enzymy następnie inaktywowano termicznie w 85°C przez 20 min. cDNA (0,1875 ng) zastosowano do PCR w czasie rzeczywistym (Power SYBR Green Master Mix, Thermo Fisher Scientific) przy użyciu starterów SM246 i SM247.

Białka

Polθ, Fl-Polθ i Polδ oczyszczono zgodnie z wcześniejszym opisem (1, 9). Pols β i λ dostarczył S. Wilson. Polκ została zakupiona od Enzymax LLC. HIV RT RT52A zoptymalizowany do krystalografii rentgenowskiej został dostarczony przez dr E. Arnolda. Polη dostarczył dr S. Arora. Pols ε i α dostarczył dr M. O’Donnell. Polγ Exo- dostarczył dr W. Copeland. M-MuLV, AMV RT i KF Pols zakupiono z New England Biolabs.

Oczyszczanie białek do krystalografii rentgenowskiej

Gen kodujący Polθ (reszty 1819 do 2590) zoptymalizowano pod względem kodonów i wklonowano do wektora pSUMO w celu wygenerowania fuzji sumo, która niesie N-końcowy znacznik 6xHis i miejsce cięcia proteazy PreScission. Wyrażanie polθ E coli Komórki Rosetta(DE3)pLysS hodowano w 37°C w pożywce LB do gęstości optycznej przy 600 nm (OD600) osiągnęło 0,3, temperaturę wzrostu obniżono następnie do 16°C, a E coli komórki były dalej hodowane. Ekspresję białka indukowano przez dodanie 0,1 mM izopropylu β-d-tiogalaktopiranozydu przy OD600 osiągnął 0,7 do 0,9. E coli komórki hodowano w 16°C przez noc i zbierano przez odwirowanie. Osad komórkowy ponownie zawieszono w buforze L [50 mM Hepes (pH 8,0), 500 mM NaCl, 0,005% (obj./obj.) Igepal CA 630 i 0,5 mM TCEP] zlizowano przez sonikację lub French Press w obecności DNazy I (20 μg/ml), RNaza A (30 μg/ml), 5 mM MgCl2, 2 mM CaCl2i 1 mM fluorku fenylometylosulfonylu, a następnie odwirowano w 12 000g przez 45 min. Fuzja 6xHis sumo została wychwycona przez chromatografię grawitacyjną na agarozie Ni-NTA, a następnie serię przemyć buforem W [50 mM Hepes (pH 8,0), 500 mM NaCl, 0,005% (obj.) Igepal CA 630, 0,5 mM TCEP i 10 mM imidazol]. Dodano pięć mililitrów buforu L i Precission Protease w celu odcięcia Polθ od znacznika 6xHis przez pozostawienie na noc w 4°C. Ciętą Polθ eluowano jeszcze dwa razy 5 ml buforu L. Eluowane białko oczyszczono do jednorodności przy użyciu kolumny HiTrap Heparin (GE Healthcare Life Sciences). Białko zatężano do 5 mg/ml w buforze octanu amonu (150 mM), KCl (150 mM), buforze Tris-HCl (pH 8,0) (40 mM), TCEP (2,5 mM) i glicerolu (1%). v/v).

Krystalizacja i określenie struktury

Warunki krystalizacji zidentyfikowano za pomocą szerokiego skriningu matrycy. Płytki do przesiewania krystalizacji siedząco-kroplowej ustawiono na 18°C ​​przy użyciu robota ARI Crystal Gryphon (ARI) i roztworów do przesiewania krystalizacji (Qiagen i Hampton Research). Reakcja Polθ (2,5 mg/ml) z hybrydą DNA/RNA (starter DNA: 5′-GCGGCTGTCATT i matryca RNA: 5′-CGUCCAAUGACAGCCGC) w obecności ddGTP (1 mM), monolaurynianu sacharozy (300 μM), MgCl2 (1 mM) i tetrachlorowodorek sperminy (20 mM) przygotowały próbkę do dyfuzji kroplowej pary siedzącej nad zbiornikiem o pojemności 50 μl zawierającym 20% (wag./obj.) etanolu poprzez zmieszanie 0,3 μl roztworu zbiornika z równą częścią reakcji rozwiązanie. Kryształy o przybliżonych wymiarach końcowych 20 μm na 20 μm na 20 μm rosły przez kolejne 2 tygodnie. Krioprotekcję osiągnięto przez zapętlenie kryształów w roztworze macierzystym z dodatkiem 25% (obj./obj.) glicerolu przed szybkim schłodzeniem w ciekłym azocie. Dane dyfrakcyjne zebrano na linii wiązki 23ID-D Narodowego Instytutu Ogólnych Nauk Medycznych i Zakładu Biologii Strukturalnej Narodowego Instytutu Raka w Zaawansowanym źródle fotonów. Kompletny zestaw danych dla Polski został zebrany, zindeksowany, zintegrowany i przeskalowany przez pakiet autoprzetwarzania na serwerze APS (GMCAproc). Program Phaser-MR w pakiecie PHENIX został użyty do zastąpienia molekularnego, COOT został użyty do przebudowy modelu, a Phenix do symulowanego wyżarzania i udoskonalania. Strukturę Pol' określono przez zastąpienie molekularne (MR) przy użyciu Pol' [Bank Danych Białkowych (PDB): 4x0q] jako modelu wyszukiwania. Pełna struktura PDB 4x0q nie mogła dać rozwiązania. Roztwór MR uzyskano jedynie przez usunięcie niektórych pętli i usunięcie dupleksu DNA/DNA z modelu. Początkowe fazy modelu białka MR zostały ulepszone poprzez cykliczne budowanie i udoskonalanie modelu, co pozwala nam powoli budować brakujące pętle, ponownie sfałdowane i zorientowane domeny palca i kciuka oraz reszty DNA/RNA na podstawie ulepszonych map gęstości elektronowej . Uzyskano ostateczny model z bardzo dobrymi statystykami dla tego zakresu rozdzielczości 3,2 Å (tabela S1).

Kwasy nukleinowe

Następujące kwasy nukleinowe zostały zakupione od Integrated DNA Technologies (wymienione jako polaryzacja 5′-3′):


Opcje dostępu

Uzyskaj pełny dostęp do dziennika przez 1 rok

Wszystkie ceny są cenami NETTO.
VAT zostanie doliczony później w kasie.
Obliczenie podatku zostanie sfinalizowane podczas realizacji transakcji.

Uzyskaj ograniczony czasowo lub pełny dostęp do artykułów w ReadCube.

Wszystkie ceny są cenami NETTO.


Funkcja polimerazy RNA

Polimeraza RNA jest najważniejszym enzymem w procesie transkrypcji. Pamiętaj, że transkrypcja to proces kopiowania dwuniciowego DNA na pojedynczą nić RNA. Mogą wyglądać nieco inaczej, ale oba są napisane w języku nukleotydy. Aby polimeraza RNA rozpoczęła swoją pracę, musi najpierw znaleźć odpowiedni region promotora. Ten region może być celem czynniki transkrypcyjne u eukariontów. Białka te wiążą się z miejscem, tworząc odpowiedni układ dla polimerazy RNA do wiązania i rozpoczęcia transkrypcji. W bakteriach występuje tylko jeden promotor, współczynnik inicjacji sigma. Proces ten można zaobserwować w przypadku uogólnionej cząsteczki polimeryzującej RNA przedstawionej poniżej, która dokonuje transkrypcji DNA. Nie pokazano czynników transkrypcyjnych.

Ponieważ polimeraza RNA wiąże się z DNA, zmienia się strukturalub kształt. Rozpoczyna to enzymatyczną reakcję łańcuchową, która powoduje wzrost nowego łańcucha nukleotydów w cząsteczkę RNA opartą na przedstawionej matrycy. Po tym, jak polimeraza RNA utworzy tę nową cząsteczkę, RNA musi zostać przetworzony i uwolniony z jądro. Teraz nazywany posłańca RNA, czyli mRNA, napotka rybosom, który ma odpowiednie mechanizmy do procesu tłumaczenie.

Podobnie jak w przypadku tłumaczenia z angielskiego na hiszpański, rybosom musi „odczytać” sekwencję RNA i przekonwertować wiadomość na język aminokwasy. Te małe cząsteczki tworzą długie łańcuchy, które zwijają się w skomplikowane kształty, aby stać się biochemicznie aktywnymi białkami. Białka te z kolei tworzą i utrzymują części DNA, a także replikują DNA. Części DNA przechowują informację genetyczną dla samego białka polimerazy RNA, które jest najpierw dekodowane przez cząsteczkę polimerazy RNA. Ta sytuacja jest naprawdę podstawą kurczaka i jajka, jeśli się nad tym zastanowić.


Dostępność danych

  1. Adams PD
  2. Afonina PV
  3. Bunkóczi G
  4. Chen VB
  5. Davis IW
  6. Echole N
  7. Szef JJ
  8. Zawieszony LW
  9. Kapral GJ
  10. Grosse-Kunstleve RW
  11. McCoy AJ
  12. Moriarty NW
  13. Oeffner R
  14. Przeczytaj RJ
  15. Richardson DC
  16. Richardson JS
  17. Terwilliger TC
  18. Zwart PH
  1. Owczarzy R
  2. Tataurow AV
  3. Wu Y
  4. Manthey JA
  5. McQuisten KA
  6. Almabrazi HG
  7. Pedersen KF
  8. Lin Y
  9. Garretson J
  10. McEntaggart NIE
  11. Marynarz CA
  12. Dawson RB
  13. Zajrzyj AS
  1. Schutz P
  2. Karlberg T
  3. van den Berg S
  4. Collins R
  5. Lehtio L
  6. Hogbom M
  7. Holmberg-Schiavone L
  8. Świątynia W
  9. Park CW
  10. Hammarström M
  11. Moche M
  12. Thorsell AG
  13. Schüler H

<p>Ta sekcja zawiera wszelkie przydatne informacje o białku, głównie wiedzę biologiczną.<p><a href='/help/function_section' target='_top'>Więcej. </a></p> Funkcja i

Zależna od RNA polimeraza RNA replikuje genom wirusa złożony z 2 segmentów RNA, RNA1 i RNA2.

<p>Ręcznie wyselekcjonowane informacje, dla których opublikowano dowody eksperymentalne.</p> <p><a href="/manual/evidences#ECO:0000269">Więcej. </a></p> Ręczne twierdzenie na podstawie eksperymentu w i


Transkrypcja / Synteza RNA

mRNA powstaje za pomocą kodów DNA.

Wyjaśnienie:

Tworzenie RNA z kodów zapisanych na DNA jest znane jako transkrypcja, w której podwójna helisa DNA rozwija się i rozwija.

Następnie są wolne rybonukleotydy, które łączą się z komplementarnymi zasadami jednej z odsłoniętych nici DNA.

Cukier i fosforan sąsiednich rybonukleotydów łączą się i tworzy się szkielet fosforanu cukru w ​​RNA. To parowanie komplementarnych rybonukleotydów wzdłuż zasad nici DNA jest monitorowane przez polimerazę RNA, enzym.

()

Pod koniec tego procesu parowania powstaje nowy jednoniciowy RNA. Nowo powstałe RNA może zostać poddane obróbce i będzie później wykorzystywane do syntezy białek, czyli translacji.

Poniższy film przedstawia podsumowanie tego, jak zachodzą procesy transkrypcji i translacji za pomocą samouczka Shockwave DNA Workshop firmy PBS.

Odpowiedź:

Wyjaśnienie:

Istnieje wiele szczegółów dotyczących obu, które można zagłębić w Wikipedii, ale główna różnica polega na:

Replikacja DNA tworzy dwie nowe dwuniciowe cząsteczki DNA z oryginalnej dwuniciowej cząsteczki DNA (replikacja semikonserwatywna).

Transkrypcja tworzy pojedynczą nić RNA z podwójnej nici DNA (wykorzystuje jedną nić DNA jako matrycę i tworzy pojedynczą nić RNA).

Odpowiedź:

Transkrypcja to proces, w którym powstaje mRNA (Messenger RNA).

Wyjaśnienie:

Oto kroki transkrypcji.

DNA jest rozpakowywane przez enzym „Helicase”.

Polimeraza RNA dodaje nukleotydy RNA do nowej nici RNA. (W RNA tymina jest zastąpiona uracylem.)

mRNA jest kompletne, gdy osiągnie kod zatrzymania na DNA.

mRNA następnie opuszcza jądro i przenosi kod do miejsc syntezy białek w cytoplazmie. (DNA nigdy nie opuszcza jądra.)


Obejrzyj wideo: From DNA to protein - 3D (Sierpień 2022).