Informacja

5.12: Biosynteza - Biologia

5.12: Biosynteza - Biologia


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

5.12: Biosynteza

Biolog obliczeniowy @ NSW

Krótki opis stanowiska: Instytut Badań Medycznych Garvana skupia wiodących na świecie klinicystów oraz badaczy zajmujących się badaniami podstawowymi i translacyjnymi, aby przełamywać bariery między tradycyjnymi dyscyplinami naukowymi i znaleźć rozwiązania dla chorób. Założona w 1963 roku misją Garvana jest wykorzystanie wszystkich informacji zakodowanych w naszym genomie, aby lepiej diagnozować, leczyć, przewidywać i zapobiegać chorobom.

Nasi naukowcy zajmują się czterema przecinającymi się tematami badawczymi: genomiką medyczną, epigenetyką i genomiką komórkową, chorobami odporności i zapaleniem, nowotworami oraz chorobami starzenia wpływającymi na kości, mózg i metabolizm. Ponadto Garvan ma trzy główne centra: Centrum Genomiki Klinicznej Kinghorn, Centrum Genomiki Komórkowej Garvan-Weizmanna oraz Centrum Genomiki Populacyjnej.

Stanowisko to opiera się na Center for Population Genomics (CPG), wspólnej inicjatywie Instytutu Badań Medycznych Garvana (Garvan) w Sydney oraz Instytutu Badań nad Dziećmi Murdoch (MCRI) w Melbourne.

Wizja CPG to świat, w którym informacje genomowe umożliwiają kompleksowe przewidywanie chorób, dokładną diagnozę i skuteczną terapię dla wszystkich ludzi. Celem CPG jest: Nawiązanie współpracy partnerskiej z różnymi społecznościami, zbieranie i analizowanie danych genomowych na transformacyjną skalę oraz stymulowanie odkryć genomicznych i sprawiedliwej medycyny genomicznej w Australii.

CPG jest prowadzone przez ekspertów w dziedzinie zaangażowania społeczności, tworzenia oprogramowania, analizy genomicznej i zarządzania projektami. Dyrektor Daniel MacArthur wcześniej pełnił funkcję współdyrektora Genetyki Medycznej i Populacyjnej w Broad Institute of MIT i Harvard, gdzie kierował rozwojem bazy danych agregacji genomu (gnomAD), największego i najczęściej używanego zbioru danych sekwencjonowania ludzkiego DNA na świecie.

Poszukujemy biologa obliczeniowego, który przyczyni się do rozwoju nowatorskich rurociągów analitycznych dla wielkoskalowych zbiorów danych genomowych, zastosuje te rurociągi do coraz większych zbiorów danych genomowych człowieka oraz będzie ściśle współpracował z innymi pracownikami Centrum i badaczami zewnętrznymi w celu przeprowadzenia i opublikowania nowe analizy danych. Biolog obliczeniowy dołączy do wysoce współpracującego zespołu obejmującego innych pracowników zajmujących się analizą i opracowywaniem metod, inżynierów oprogramowania, kierowników projektów, specjalistów społeczności i stażystów.

W ramach misji Centrum Genomiki Populacyjnej zespół ten będzie odpowiedzialny za przetwarzanie danych generowanych w ramach nowych projektów sekwencjonowania, a także agregację zasobów publicznych w celu stworzenia nowego źródła genetyki człowieka, które odzwierciedla niezwykłą różnorodność populacji Australii. Zespół będzie również zarządzać genomem, egzomem, sekwencjami RNA i innymi zestawami danych genomicznych od pacjentów cierpiących na rzadkie choroby i członków ich rodzin, mając na celu poprawę diagnozowania ciężkich chorób genetycznych. Analizy te będą wykonywane na skalowalnej platformie obliczeniowej opartej na chmurze. Powstałe zbiory danych i oprogramowanie będą szeroko udostępniane szerszej społeczności naukowej, maksymalizując ich wpływ na wyniki w nauce i zdrowiu.

Chociaż stanowisko to będzie wiązało się z bezpośrednim kontaktem z najnowocześniejszą nauką genomiczną, miarą sukcesu i promocji będzie opracowywanie i wdrażanie złożonych metod analizy na dużą skalę, a nie tradycyjne metryki akademickie, takie jak wiodące publikacje. Stanowiska te są finansowane centralnie i nie są uzależnione od stypendiów lub innego pozyskiwania funduszy. Role te będą najbardziej odpowiednie dla osób z dużym doświadczeniem w dorobku naukowym, które są zainteresowane dalszym przyczynianiem się do wywierania wpływu na naukę, ale nie tradycyjną ścieżką kariery akademickiej.

Aby dostosować się do wpływu COVID-19, uruchomiliśmy Centrum w całkowicie zdalnym modelu i jesteśmy otwarci na odległe stanowiska w dłuższej perspektywie.

Jest to 3-letnie stanowisko w pełnym wymiarze godzin z rocznym zakresem wynagrodzeń od 92 000 do 120 000 000 USD, z uwzględnieniem umiejętności i doświadczenia, a także korzyści emerytalnych i pakowania wynagrodzeń oraz możliwości przedłużenia.

Biolog obliczeniowy będzie częścią Zespołu Analiz Centrum, który będzie odpowiedzialny za opracowanie skalowalnych potoków do złożonych analiz genomicznych, za ścisłą współpracę z zespołem ds. rozwoju oprogramowania Centrum w celu wdrożenia ich na skalę produkcyjną na podstawie danych pochodzących od dziesiątek tysięcy osób, oraz do przeprowadzania kontroli jakości i analizy w otrzymanych zestawach danych. Zespół ten będzie się składał z członków o zróżnicowanych umiejętnościach z zakresu biologii obliczeniowej, genetyki statystycznej i genetyki populacyjnej, którzy będą wspólnie pracować nad tworzeniem tych potoków, przeprowadzaniem analiz i wnoszeniem znacznego wkładu w publikacje naukowe o dużym znaczeniu.

Kluczowe obowiązki obejmują:

Opracowywanie nowych podejść i rygorystyczne porównywanie istniejących podejść do analizy sekwencjonowania genomu na dużą skalę, sekwencjonowania RNA, sekwencjonowania jednokomórkowego RNA i innych typów danych genomowych w dziesiątkach tysięcy próbek ludzkich

Opracowywanie kodu prototypowego do podejść analitycznych i ścisła współpraca z zespołem inżynierów oprogramowania, aby zapewnić, że ten kod może być wdrażany na dużą skalę i udostępniany jako oprogramowanie typu open source

Przeprowadzanie rygorystycznej kontroli jakości i analizy ogromnych zestawów danych genomicznych

Regularne spotkania z praktykantami Centrum i innymi pracownikami naukowymi w celu zidentyfikowania głównych wyzwań związanych z przetwarzaniem i analizą danych oraz aktywna praca z innymi członkami zespołu w celu określenia rozwiązań

Aktywny udział w dyskusjach naukowych na temat najlepszych podejść do zrozumienia dużych zbiorów danych generowanych i obsługiwanych przez Centrum

Aktywny wkład w rozwój najlepszych praktyk w zakresie programowania i analizy poprzez regularne spotkania przeglądowe kodu i inne działania, takie jak programowanie w parach

Kluczowe umiejętności i doświadczenie to:

Albo magister lub doktor w dziedzinie biologii obliczeniowej, genomiki funkcjonalnej, uczenia maszynowego, statystyki lub pokrewnej dziedziny, albo równoważna całkowita ilość bezpośredniego doświadczenia zawodowego w tych dziedzinach

Spore doświadczenie z Pythonem i R lub podobnym

Wykazane doświadczenie w pracy w środowiskach o wysokiej wydajności lub w chmurze

Wykazane doświadczenie z kontrolą wersji i repozytoriami oprogramowania

Bezpośrednie doświadczenie w przeprowadzaniu kontroli jakości i analizie zbiorów danych genomowych lub innych złożonych typów danych

Wysoce autonomiczny i zmotywowany: potrafi definiować i zarządzać wykonaniem nowatorskich strategii analizy w swojej dziedzinie wiedzy

Dobre umiejętności w zakresie komunikacji pisemnej: umiejętność efektywnego współtworzenia artykułów i raportów technicznych

Prawdziwa pasja do tworzenia oprogramowania typu open source i wnoszenia kodu do szerszego ekosystemu biologii obliczeniowej

Wysoce współpracujący: bardziej skoncentrowany na rozwiązywaniu ważnych problemów biologicznych i medycznych poprzez pracę z innymi niż na zdobywaniu indywidualnego uznania i chętny do zaangażowania się z innymi członkami zespołu z różnych środowisk do wykonywania złożonych zadań naukowych

Mentalność rozwiązywania problemów: umiejętność pokonywania złożonej i dynamicznej serii przeszkód technicznych oraz szybkiego obracania się w razie potrzeby, aby zbudować pierwszy w swoim rodzaju projekt badawczy kogoś, kto zidentyfikuje problemy, nawet jeśli wykraczają poza jego bezpośrednie uprawnienia, i współpracuje z innymi członkami zespołu, aby je rozwiązać

Korzystne byłoby bezpośrednie doświadczenie z przetwarzaniem w chmurze i analizą bardzo dużych zbiorów danych genomicznych

Bezpośrednie doświadczenie w zakresie złożonych wizualizacji danych lub metod uczenia maszynowego również byłoby plusem

Aby ubiegać się o to stanowisko, prosimy o złożenie aplikacji wraz z CV i listem motywacyjnym jako jednym dokumentem, wyjaśniając dlaczego jesteś zainteresowany tą rolą. Sprawdzamy zgłoszenia w miarę ich napływania. Jeśli uważasz, że jesteś odpowiednią osobą do tej roli, chcielibyśmy usłyszeć, jak wyróżniają Cię Twoje możliwości, osiągnięcia i doświadczenie. Tylko kandydaci z pełnymi prawami do pracy w Australii mogą ubiegać się o tę rolę.


Tło

Środowiska ekstremalne, na ogół charakteryzujące się nieprawidłową temperaturą, pH, ciśnieniem, zasoleniem, toksycznością i poziomem promieniowania, są zamieszkiwane przez różne organizmy – ekstremofile – które są specjalnie przystosowane do tych szczególnych warunków. Badania nad tymi mikroorganizmami doprowadziły do ​​opracowania ważnych technik biologii molekularnej, takich jak reakcja łańcuchowa polimerazy (PCR) [1, 2], a zatem dalsze badania były w dużej mierze stymulowane przez zainteresowanie przemysłu faktem, że mechanizmy przetrwania tych mikroorganizmów mogą zostać przekształcone w wartościowe zastosowania, od oczyszczania ścieków po diagnostykę chorób zakaźnych i genetycznych [3].

Drobnoustroje halofilne to ekstremofile, które są w stanie przetrwać w wysokiej osmolarności w warunkach nadsolnych albo przez utrzymywanie wysokiego zasolenia w swojej cytoplazmie, albo przez wewnątrzkomórkową akumulację osmoprotektantów, takich jak ektoina i betaina [4]. C. salexigens jest halofilną Gammaproteobacterium z rodziny Halomonadaceae o wszechstronnym metabolizmie umożliwiającym nie tylko szybki wzrost na wielu różnych prostych związkach węgla jako jedynym źródle węgla i energii, ale także odporność na węglowodory nasycone i aromatyczne oraz metale ciężkie [5, 6]. C. salexigens ze zdolnością do wzrostu w szerokim zakresie zasolenia [0,5-4 M NaCl] jest najbardziej euryhalinową z bakterii [7], a do zrozumienia mechanizmów osmoregulacyjnych u bakterii halofilnych został wykorzystany jako organizm modelowy [5, 7–9]. Ponadto, C. salexigens ma również wiele obiecujących zastosowań biotechnologicznych jako źródło kompatybilnych substancji rozpuszczonych, tolerujących sól i rekombinowanych enzymów, biosurfaktantów i egzopolisacharydów [10].

Sekwencja genomu ekstremofili, takich jak archeon redukujący siarczany Archaeaglobus fulgidus[11], archeon halofilny Halobakterie gatunek NRC-1 [12] i bakteria kwasolubna Acidithiobacillus ferrooxidans[13] zostały zgłoszone wcześniej. Od czasu publikacji genomu C. salexigens DSM 3043 [14] wiedza biologiczna na temat tego szczepu znacznie wzrosła i opracowano różne metody umożliwiające analizę genomową i manipulacje genetyczne [15, 16]. Z drugiej strony nie przeprowadzono jeszcze systematycznej analizy jego możliwości metabolicznych i biotechnologicznych. Wynika to na pewnym poziomie z braku w silico kompleksowy model metaboliczny, który umożliwia integrację kanonicznych danych doświadczalnych w spójny sposób.

Rekonstrukcja metaboliczna jest niezautomatyzowanym i iteracyjnym procesem podejmowania decyzji, za pomocą którego geny, enzymy, reakcje i metabolity uczestniczące w aktywności metabolicznej układu biologicznego są identyfikowane, kategoryzowane i łączone w sieć [17]. Proces rekonstrukcji został poddany przeglądowi koncepcyjnemu w literaturze [17–22], a ostatnio opublikowano standardowy protokół operacyjny zawierający szczegółowy przegląd niezbędnych danych i kroków [23]. Do tej pory opublikowano rekonstrukcje metaboliczne w skali genomu dla ponad 50 organizmów i oczekuje się, że liczba ta gwałtownie wzrośnie. W związku z tym rośnie potrzeba opracowania zautomatyzowanych lub przynajmniej półautomatycznych sposobów rekonstrukcji sieci metabolicznych. Dostępna jest ograniczona liczba narzędzi programowych, takich jak Pathway tools [24], metaSHARK [25], Simpheny (Genomatica), które mają na celu wspomaganie i ułatwianie procesu rekonstrukcji. Jednak ostatnie prace przeglądowe [18, 26] zwracają uwagę na aktualne problemy z adnotacjami genomu i bazami danych, które sprawiają, że automatyczne rekonstrukcje są trudne i wymagają ręcznej oceny. Rekonstrukcje metaboliczne w skali genomu zostały z powodzeniem zastosowane do kilku organizmów eukariotycznych (np. Saccharomyces cerevisiae[21, 27–29], człowiek [30], Arabidopsis thaliana[31]), prokariotyczny (np. Escherichia coli[32–34], Bacillus subtilis[35], Helicobacter pylori[36, 37], Lactococcus lactis[38], Staphylococcus aureus[39, 40], Clostridium acetobutylicum[41], Pseudomonas putida[42], Pseudomonas aeruginosa[43], Geobacter metalireducens[44], Corynebacterium glutamicum[45]) i archeonów (np. Methansoarcina barkeri[46], Halobacterium salinarum[47] gatunki). Będąc użytecznym przewodnikiem do identyfikacji i wypełniania luk w wiedzy, te sieci metaboliczne zostały wykorzystane do symulacji zachowania komórek w różnych warunkach genetycznych i fizjologicznych, kontekstualizacji danych o wysokiej przepustowości, kierowania odkryciami opartymi na hipotezach, badania relacji wielogatunkowych i analiza topologiczna (patrz [17] dla obszernego przeglądu).

Tutaj rekonstrukcja w skali genomu C. salexigens Metabolizm DSM 3043 został ustalony na podstawie informacji genomicznych, biochemicznych i fizjologicznych. Będąc pierwszym kompleksowym modelem metabolicznym bakterii halofilnej, oznaczono ją jako i OA584 zgodnie z konwencją nazewnictwa zaproponowaną przez [33]. Potencjał predykcyjny modelu został zweryfikowany nie tylko na podstawie danych literaturowych dotyczących in vivo C. salexigens cechy fenotypowe, transport i zastosowanie różnych substratów, ale także wbrew obserwacjom doświadczalnym dotyczącym szlaków syntezy choliny – betainy i ektoiny, które są ważnymi elementami mechanizmu osmoadaptacji.


Wyniki

Wykorzystaliśmy model sieci FOCI do oszacowania sieci koekspresji dla 5007 otwartych ramek odczytu (ORF) drożdży. Dane do tej analizy pochodzą z publicznie dostępnych pomiarów mikromacierzy ekspresji genów w różnych warunkach fizjologicznych. Metoda FOCI zakłada liniowy model powiązania między zmiennymi i oblicza zależności zależności i niezależności dla par zmiennych aż do zmiennej warunkowej pierwszego rzędu (czyli pojedynczej). Bardziej szczegółowe opisy danych i algorytmu szacowania sieci znajdują się w sekcji Materiały i metody.

Na podstawie współczynnika fałszywie dodatnich wyników na krawędziach równego 0,001 (patrz Materiały i metody), oszacowana sieć danych dotyczących ekspresji drożdży ma 11 450 krawędzi. Możliwe jest, że procedura estymacji sieci FOCI daje niepodłączone podgrafy - czyli grupy genów, które są ze sobą spokrewnione, ale nie są połączone z żadnymi innymi genami. Jednak sieć koekspresji drożdży, którą oszacowaliśmy, zawiera pojedynczy gigantyczny połączony komponent (GCC, największy podgraf, w którym istnieje ścieżka między każdą parą wierzchołków) z 4686 wierzchołkami i 11416 krawędziami. Kolejny co do wielkości połączony komponent obejmuje tylko cztery wierzchołki, więc GCC reprezentuje relacje między większością genów w genomie. Na rysunku 1 pokazujemy uproszczenie sieci FOCI zbudowanej z zachowaniem 4000 najsilniejszych krawędzi. Zastosowaliśmy tę procedurę progową, aby zapewnić zrozumiałą dwuwymiarową wizualizację wykresu. Wszystkie omówione poniżej wyniki pochodzą z analiz całego GCC sieci FOCI.

Uproszczenie drożdżowej sieci koekspresji FOCI skonstruowanej przez zachowanie 4000 najsilniejszych krawędzi (= 1729 wierzchołków). Kolorowe wierzchołki reprezentują podzbiór lokalnie odrębnych podgrafów liter sieci FOCI, jak w Tabeli 2, a dalsze szczegóły można tam znaleźć. Niektóre z lokalnie odrębnych podgrafów z Tabeli 2 nie są przedstawione na tym rysunku, ponieważ obejmują podgrafy, których wagi krawędzi nie znajdują się na górnych 4000 krawędzi.

Średnie, mediany i modalne wartości stopnia wierzchołków w GCC wynoszą odpowiednio 4,87, 4 i 2. Oznacza to, że każdy gen wykazuje znaczące związki ekspresji średnio z około pięcioma innymi genami, a najczęstszą formą związku są dwa inne geny. Większość genów ma pięciu lub mniej sąsiadów, ale istnieje niewielka liczba genów (349) z więcej niż 10 sąsiadami w sieci FOCI, maksymalny stopień na wykresie wynosi 28 (Rysunek 2a). Tak więc około 7% genów wykazuje znaczące relacje ekspresji z dość dużą liczbą innych genów. Łączność sieci FOCI nie jest zgodna z rozkładem mocy prawa (patrz plik danych dodatkowych 1, aby uzyskać wykres log-log tego rozkładu). Oszacowaliśmy rozkład odległości ścieżek między parami genów (zdefiniowanych jako najmniejsza liczba krawędzi grafu oddzielających parę) losowo wybierając 1000 wierzchołków źródłowych w GCC i obliczając odległość ścieżki od każdego wierzchołka źródłowego do każdego innego genu w sieci (Rysunek 2b). Średnia odległość ścieżki wynosi 6,46 kroków, a mediana 6,0 (tryb = 7). Maksymalna odległość ścieżki to 16 kroków. Dlatego w GCC sieci FOCI losowe pary genów są zazwyczaj oddzielone sześcioma lub siedmioma krawędziami.

Właściwości topologiczne sieci koekspresji drożdży FOCI. Dystrybucja (a) stopnie wierzchołków i (b) długości ścieżek dla sieci.

Spójność sieci FOCI ze znanymi szlakami metabolicznymi

Aby ocenić znaczenie biologiczne naszej oszacowanej sieci koekspresji porównaliśmy skład 38 znanych szlaków metabolicznych (Tabela 1) z naszą siecią koekspresji drożdży FOCI. W sieci informacyjno-biologicznej geny zaangażowane w tę samą ścieżkę (ścieżki) powinny być reprezentowane jako spójne fragmenty większego wykresu. Oznacza to, że przy założeniu, że interakcje szlaków wymagają współregulacji i koekspresji, geny w danym szlaku powinny znajdować się stosunkowo blisko siebie w szacowanej globalnej sieci.

Zastosowaliśmy podejście polegające na zapytaniu szlaków, aby zbadać 38 szlaków metabolicznych w stosunku do naszej sieci FOCI. Dla każdej ścieżki obliczyliśmy wielkość zwaną „wartością spójności”, która mierzy, jak dobrze ścieżka jest odzyskiwana w danym modelu sieci (patrz Materiały i metody). Spośród 38 przetestowanych ścieżek 19 ma wartości koherencji, które są istotne w porównaniu z rozkładem losowych ścieżek o tej samej wielkości (P <0,05 patrz Materiały i metody). Większość badanych przez nas szlaków metabolizmu węglowodanów i aminokwasów jest spójnie reprezentowana w sieci FOCI. Z każdej z głównych kategorii szlaków metabolicznych wymienionych w Tabeli 1, tylko metabolizm lipidów oraz metabolizm kofaktorów i witamin nie są dobrze reprezentowane w sieci FOCI.

Pięć największych spójnych szlaków to glikoliza/glukoneogeneza, cykl TCA, fosforylacja oksydacyjna, metabolizm puryn i synteza N-glikanów. Inne szlaki, które wyróżniają się w naszej analizie, to cykl glioksylanowy (6 z 12 genów w największej spójnej podsieci), biosynteza waliny, leucyny i izoleucyny (10 z 15 genów), metabolizm metioniny (6 z 13 genów), fenyloalanina, tyrozyna, i metabolizm tryptofanu (dwie podsieci, każda po 6 genów).Kilka spójnych podzbiorów sieci FOCI generowanych przez te zapytania o ścieżkę zostało zilustrowanych w pliku danych dodatkowych 1.

Połączona analiza metabolizmu węglowodanów podstawowych

Oprócz tego, że jest spójny z poszczególnymi ścieżkami, użyteczny model sieci powinien uchwycić interakcje między ścieżkami. Aby zbadać ten problem, przepytaliśmy sieć FOCI o połączone ścieżki i ponownie zmierzyliśmy jej spójność. Ilustrujemy jedno takie połączone zapytanie oparte na czterech powiązanych szlakach zaangażowanych w metabolizm węglowodanów: glikoliza/glukoneogeneza, metabolizm pirogronianu, cykl TCA i cykl glioksylanowy.

Rysunek 3 ilustruje największy podgraf wyodrębniony w tej połączonej analizie. Połączone zapytanie daje podzbiór sieci FOCI, który jest większy niż suma podgrafów oszacowanych oddzielnie od poszczególnych ścieżek, ponieważ dopuszcza również geny niebędące zapytaniami, które są połączone z wieloma ścieżkami. Węzły wykresu są pokolorowane zgodnie z ich przynależnością do każdej z czterech ścieżek zdefiniowanych w Encyklopedii Genów i Genomów z Kioto (KEGG). Wiele produktów genów jest przypisanych do wielu szlaków. Jest to szczególnie widoczne w odniesieniu do cyklu glioksylanowego, jedyne geny jednoznacznie przypisane do tego szlaku to ICL1 (koduje liazę izocytrynianową) i ICL2 (liaza 2-metyloizocytrynianowa).

Największy połączony podgraf wynikający z połączonego zapytania o cztery szlaki zaangażowane w metabolizm węglowodanów: glikoliza/glukoneogeneza (czerwony), metabolizm pirogronianu (żółty), cykl TCA (zielony) i cykl glioksylanowy (różowy). Geny kodujące białka zaangażowane w więcej niż jeden szlak są wyróżnione wieloma kolorami. Niezabarwione wierzchołki reprezentują geny nie będące szlakami, które zostały odzyskane w połączonym zapytaniu szlaków. Więcej szczegółów znajdziesz w tekście.

W tym połączonym szlaku zapytań cykl TCA, glikoliza/glukoneogeneza i cykl gliksoilanu są reprezentowane głównie przez pojedynczy dwuetapowy połączony podwykres (patrz Materiały i metody). Z drugiej strony metabolizm pirogronianu jest reprezentowany przez co najmniej dwa odrębne podgrafy, z których jeden zawiera <PCK1, dal7, MDH2, MLS1, ACS1, ACH1, LPD1, MDH1> i inne, w tym <GLO1, GLO2, DLD1, CYB2>. Ten drugi zestaw genów koduje enzymy, które uczestniczą w gałęzi szlaku metabolizmu pirogronianu, który prowadzi do degradacji metyloglioksalu (metyloglioksal → L-laktaldehyd → L-mleczan → pirogronian i metyloglioksal → (r)-S-laktoilo-glutation → D-laktaldehyd → D-mleczan → pirogronian) [12, 13]. W gałęzi metabolizmu metyloglioksalu, która obejmuje S-laktoilo-glutation, metyglioksal jest skondensowany z glutationem [12]. Co ciekawe, dwa sąsiadujące geny niebędące zapytaniami, GRX1 (sąsiad GLO2) oraz TTR1 (sąsiad z CYB2), kodują białka o aktywności transferazy glutationowej.

Pozycja czegoś FBP1 w połączonym zapytaniu również jest ciekawa. Produkt FBP1 to fruktozo-1,6-bisfosfataza, enzym, który katalizuje konwersję 1,6-bisfosforanu beta-d-fruktozy do beta-D-fruktozo-6-fosforanu, reakcję związaną z glikolizą. Jednak w naszej sieci jest najściślej związany z genami przypisanymi do metabolizmu pirogronianu i cyklu glioksylanowego. Sąsiedzi FBP1 w tym zapytaniu uwzględnij ICL1, MLS1, SFC1, PCK1 oraz IDP3. Z wyjątkiem IDP3, promotory wszystkich tych genów (w tym FBP1) mają co najmniej jedną poprzedzającą sekwencję aktywacyjną, którą można sklasyfikować jako element odpowiedzi na źródło węgla (CSRE) i która odpowiada na aktywator transkrypcji Cat8p [14]. Ten zestaw genów ulega ekspresji w niefermentacyjnych warunkach wzrostu przy braku glukozy, warunkach charakterystycznych dla przesunięcia diauxowego [15]. Biorąc pod uwagę inne geny w pobliżu FBP1 w połączonym zapytaniu dotyczącym ścieżki znajdujemy, że ACS1, IDP2, SIP4, MDH2, ACH1 oraz YJL045w wykazano, że wszystkie mają sekwencje aktywacyjne podobne do CSRE i/lub są przynajmniej częściowo zależne od Cat8p [14]. Związek między tymi genami aktywowanymi Cat8p utrzymuje się, gdy szacujemy sieć FOCI bez uwzględnienia danych DeRisi i inni. [15] sugerując, że ten zestaw interakcji nie jest jedynie konsekwencją włączenia danych zebranych z kultur podlegających przesunięciu diauxicznemu.

Włączenie szeregu innych genów do podsieci metabolizmu węglowodanów jest zgodne z niezależnymi dowodami z literatury. Na przykład McCammon i inni. [16] zidentyfikowane YER053c jak wśród zestawu genów, których poziomy ekspresji zmieniły się w mutantach cyklu TCA.

Chociaż wiele powiązań między grupami genów ujawnionych w tych podgrafach można interpretować albo w kategoriach szlaków zapytań użytych do ich skonstruowania, albo w odniesieniu do szlaków pokrewnych, wiele powiązań nie ma oczywistej interpretacji biologicznej. Na przykład ogon po lewej stronie wykresu na rysunku 3, złożony z LSC1, PTR2, PAD1, OPT2, ARO10 oraz PSP1 nie ma jasnego znanego związku.

Lokalnie odrębne podgrafy

Opisana powyżej analiza szlaków metabolicznych zapewnia test stopnia, w jakim znane szlaki są reprezentowane na wykresie FOCI. Oznacza to, że założyliśmy pewną wcześniejszą wiedzę na temat struktury sieci podzbiorów genów i zapytaliśmy, czy nasza oszacowana sieć jest spójna vis-à-vis tę wcześniejszą wiedzę. I odwrotnie, można chcieć znaleźć interesujące i odrębne podgrafy w sieci FOCI bez wstrzykiwania jakiejkolwiek wcześniejszej wiedzy i zapytać, czy takie podgrafy odpowiadają poszczególnym procesom lub funkcjom biologicznym. Aby rozwiązać ten drugi problem, opracowaliśmy algorytm do obliczania „lokalnie odrębnych podgrafów” sieci koekspresji drożdży FOCI, jak opisano szczegółowo w sekcji Materiały i metody. Krótko mówiąc, jest to nienadzorowany algorytm przeszukiwania grafów, który definiuje „atrakcyjność” pod względem lokalnej topologii krawędzi i rozkładu lokalnych wag krawędzi na grafie. Celem tego algorytmu jest znalezienie połączonych podgrafów, których rozkład ciężaru krawędzi różni się od krawędzi otaczających podgraf, zatem te lokalnie odrębne podgrafy można traktować jako wierzchołki i powiązane z nimi krawędzie, które „wyróżniają się” z tła większego wykresu jako całości.

Ograniczyliśmy wielkość podwykresów do od siedmiu do 150 genów i użyliśmy kwadratowych współczynników korelacji marginalnej jako funkcji ważenia na krawędziach wykresu FOCI. Znaleźliśmy 32 lokalnie odrębne podgrafy, zawierające łącznie 830 genów (Tabela 2). Dwadzieścia cztery z 32 podgrafów mają spójne terminy adnotacji Gene Ontology (GO) [17] z P-wartości mniejsze niż 10 -5 (patrz Materiały i metody). Wskazuje to, że większość lokalnie odrębnych podgrafów jest bardzo wzbogacona w odniesieniu do genów zaangażowanych w określone procesy lub funkcje biologiczne. Elementy 21 największych lokalnie odrębnych podgrafów są wyróżnione na rysunku 1. Pełna lista podgrafów i przypisanych do nich genów znajduje się w pliku danych dodatkowych 2.

Pięć największych lokalnie odrębnych podgrafów ma następujące podstawowe adnotacje GO: biosynteza białek (podgraf A i B) biogeneza i składanie rybosomów (podgraf C) odpowiedź na stres i metabolizm węglowodanów (podgraf K) i sporulacji (podgraf N). Kilka z tych podgrafów wykazuje bardzo wysoką specyficzność dla genów z określonymi adnotacjami GO. Na przykład w podgrafach A i B około 97% (32 z 33) i 95,5% (64 z 67) genów przypisano terminowi GO „biosynteza białek”.

Podgraf P jest również stosunkowo duży i zawiera wiele genów odgrywających rolę w replikacji i naprawie DNA. Podobnie, 21 z 34 genów opatrzonych adnotacjami w podgrafie F odgrywa rolę w katabolizmie białek. Trzy średniej wielkości podgrafy (S, T, U) są silnie związane z mitotycznym cyklem komórkowym i cytokinezą. Inne przykłady podgrafów o bardzo wyraźnych rolach biologicznych to podgraf R (histony) i podgraf Z (geny zaangażowane w koniugację i rozmnażanie płciowe). Podgraf X zawiera geny odgrywające rolę w metabolizmie lub transporcie metioniny.

Niektóre lokalnie odrębne podgrafy mogą być dalej rozkładane. Na przykład podwykres K zawiera co najmniej dwie podgrupy. Jeden z nich składa się głównie z genów kodujących białka opiekuńcze: STI1, SIS1, HSC82, HSP82, AHA1, SSA1, SSA2, SSA4, KAR2, YPR158w, YLR247c. Druga grupa zawiera geny zaangażowane głównie w metabolizm węglowodanów. Te dwie podgrupy są połączone ze sobą wyłącznie poprzez HSP42 oraz HSP104.

Trzy z lokalnie odrębnych podgrafów - Q, W i CC - składają się głównie z genów, dla których nie ma adnotacji procesu biologicznego GO. Co ciekawe, większość genów przypisanych do tych trzech grup znajduje się w regionach subtelomerycznych. Te trzy podgrafy same w sobie nie są bezpośrednio połączone w grafie FOCI, więc ich regulacja prawdopodobnie nie będzie po prostu przykładem regulacji wyciszenia subtelomerowego [18]. Podgraf Q obejmuje 26 genów, z których pięć (YRF1-2, YRF1-3, YRF1-4, YRF1-5, YRF1-6) odpowiadają ORF kodującym kopie białka helikazy Y' 1 [19]. Osiem dodatkowych genów (YBL113c, YEL077c, YHL050c, YIL177c, YJL225c, YLL066c, YLL067c, YPR204w) przypisane do tego podgrafu również kodują helikazy. Ten podgraf helikazy jest ściśle powiązany z podgrafem P, który zawiera liczne geny zaangażowane w replikację i naprawę DNA (patrz Ryc. 1). Podgraf W zawiera 10 genów, z których tylko jednemu przypisano proces GO, termin funkcji lub składnika. Jednak dziewięć z 10 genów w podgrafie (PAU1, PAU2, PAU4, PAU5, PAU6, YGR294w, YLR046c, YIR041w, YLL064c) należą do rodziny genów seripauperyny [20], które występują głównie subtelomerycznie i które kodują mannoproteiny ściany komórkowej i mogą odgrywać rolę w utrzymaniu integralności ściany komórkowej [18]. Innym przykładem podwykresu odpowiadającego rodzinie wielogenowej jest podwykres CC, który obejmuje dziewięć subtelomerowych ORF, z których sześć koduje białka z rodziny COS. Białka Cos są związane z błoną jądrową i/lub retikulum endoplazmatycznym i biorą udział w odpowiedzi na rozwinięte białka [21].

Jako ostatni przykład rozważmy podwykres FF, który składa się z siedmiu ORF (YAR010c, YBL005w-A, YJR026w, YJR028w, YML040w, YMR046c, YMR051c), z których wszystkie są częścią pierwiastków Ty, kodujących elementy strukturalne aparatu retrotranspozonowego [22, 23]. Ten zestaw genów dobrze ilustruje fakt, że wyznaczenie lokalnie odrębnych grup może prowadzić do odkrycia wielu interesujących interakcji. Wśród tych siedmiu genów na oszacowanym wykresie FOCI jest tylko sześć krawędzi, a marginalne korelacje między miarami korelacji tych genów są stosunkowo słabe (średnia r

0,62). Mimo to lokalny rozkład wag krawędzi na wykresie FOCI jest taki, że ta grupa jest wyróżniona jako podgraf będący przedmiotem zainteresowania. Lokalnie silne podgrafy, takie jak te, mogą być również użyte jako punkt wyjścia do dalszych procedur wyszukiwania grafów. Na przykład, zapytanie sieci FOCI o bezpośrednich sąsiadów genów w podrozdziale FF daje trzy dodatkowe ORFy - YBL101w-A, YBR012w-B, oraz RAD10. Obie YBL101w-A oraz YBR012w-B są elementami Ty, natomiast RAD10 koduje egzonukleazę odgrywającą rolę w rekombinacji.


Przedmioty podyplomowe

Wspólny program MIT-WHOI w dziedzinie oceanografii

7.410 Stosowane statystyki

Wymagania wstępne: Zgoda instruktora
G (wiosna)
3-0-9 jednostek
Można powtórzyć na kredyt.

Stanowi wprowadzenie do współczesnej statystyki stosowanej. Tematy obejmują metody estymacji oparte na prawdopodobieństwie, przedziały ufności oraz testowanie hipotez z ładowaniem początkowym szeregów czasowych, modelowanie modeli liniowych, regresję nieparametryczną i wybór modelu. Zorganizowane wokół przykładów zaczerpniętych z najnowszej literatury.

7.411 Seminaria z oceanografii biologicznej

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Wybrane zagadnienia z oceanografii biologicznej.

7.421 Problemy w oceanografii biologicznej

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Zaawansowane problemy oceanografii biologicznej z zadanymi lekturami i konsultacjami.

Informacje: M. Neubert (WHOI)

7.430 Tematy w ilościowej nauce o morzu

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusje na temat ilościowej ekologii morskiej. Tematy zmieniają się z roku na rok.

7.431 Tematy w ekologii morskiej

Wymagania wstępne: Zgoda instruktora
G (jesień)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusje na temat zasad i procesów ekologicznych w populacjach, zbiorowiskach i ekosystemach morskich. Tematy zmieniają się z roku na rok.

7.432 Tematy w fizjologii i biochemii morza

Wymagania wstępne: Zgoda instruktora
G (wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusje na temat procesów fizjologicznych i biochemicznych zachodzących w organizmach morskich. Tematy zmieniają się z roku na rok.

7.433 Tematy w oceanografii biologicznej

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusje z oceanografii biologicznej. Tematy zmieniają się z roku na rok.

7.434 Tematy w biologii zooplanktonu

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusje z biologii morskiego zooplanktonu. Tematy zmieniają się z roku na rok.

7.435 Tematy w biologii bentosowej

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusje z biologii bentosu morskiego. Tematy zmieniają się z roku na rok.

7.436 Tematy w biologii fitoplanktonu

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusja na temat biologii fitoplanktonu morskiego. Tematy zmieniają się z roku na rok.

7.437 Tematy w molekularnej oceanografii biologicznej

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusja z biologii molekularnej oceanografii. Tematy zmieniają się z roku na rok.

7.438 Tematy w zachowaniu zwierząt morskich

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusja na temat biologii behawioralnej zwierząt morskich. Tematy zmieniają się z roku na rok.

7.439 Tematy w mikrobiologii morskiej

Wymagania wstępne: Zgoda instruktora
G (jesień)
2-0-4 jednostki
Można powtórzyć na kredyt.

Wykłady i dyskusja na temat biologii morskich prokariontów. Tematy zmieniają się z roku na rok.

7.440 Wprowadzenie do ekologii matematycznej

Wymagania wstępne: Rachunek I (GIR), 1.018[J], lub pozwolenie instruktora
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
3-0-9 jednostek

Obejmuje podstawowe modele wzrostu populacji, demografii, interakcji populacji (konkurencja, drapieżnictwo, mutualizm), sieci pokarmowe, zbioru i chorób zakaźnych oraz narzędzia matematyczne wymagane do ich analizy. Ponieważ narzędzia te są również podstawą analizy modeli w biochemii, fizjologii i zachowaniu, temat ten ma również szerokie znaczenie dla studentów, których zainteresowania nie ograniczają się do problemów ekologicznych.

7.470 Oceanografia biologiczna

Wymagania wstępne: Zgoda instruktora
G (wiosna)
3-0-9 jednostek

Przeznaczony dla studentów z zaawansowanym wykształceniem biologicznym. Intensywny przegląd oceanografii biologicznej. Omówiono główne paradygmaty oraz zbadano zależność procesów biologicznych w oceanie od fizycznych i chemicznych aspektów środowiska. Bada różnorodność siedlisk morskich, główne grupy taksonów zamieszkujących te siedliska oraz ogólną biologię różnych taksonów: produkcję i zużycie materiału organicznego w oceanach, a także czynniki kontrolujące te procesy. Różnorodność gatunków, struktura morskich sieci troficznych i przepływ energii w różnych siedliskach morskich są szczegółowe i skontrastowane.

7.491 Badania w oceanografii biologicznej

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna, lato)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Kierowane badaniami w zakresie oceanografii biologicznej nieprowadzące do pracy magisterskiej i zainicjowane przed egzaminem kwalifikacyjnym.

Mikrobiologia (MIKRO)

7.492[J] Metody i problemy w mikrobiologii

Ten sam temat co 1.86[J], 20.445[J]
Wymagania wstępne: Brak
G (jesień)
3-0-9 jednostek

Studenci przeczytają i omówią podstawową literaturę obejmującą kluczowe obszary badań mikrobiologicznych, z naciskiem na metody i podejścia stosowane do zrozumienia i manipulowania drobnoustrojami. Preferencja dla studentów I roku Mikrobiologii i Biologii.

7.493[J] Genetyka i ewolucja drobnoustrojów

Ten sam temat co 1.87[J], 12.493[J], 20.446[J]
Prereq: 7.03, 7.05 lub pozwolenie instruktora
G (jesień)
4-0-8 jednostek

Obejmuje aspekty genetycznych i genomicznych analiz drobnoustrojów, centralnego dogmatu, horyzontalnego transferu genów i ewolucji.

A. D. Grossman, O. Cordero

7.494 Problemy badawcze w mikrobiologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna, lato)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Kierowane badania w dziedzinie mikrobiologii i inżynierii.

7.498 Doświadczenie w nauczaniu w mikrobiologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Dla wykwalifikowanych studentów studiów magisterskich na kierunku Mikrobiologia zainteresowanych nauczaniem. Nauczanie w klasie lub laboratorium pod kierunkiem członka wydziału.

7.499 Rotacje badawcze w mikrobiologii

Wymagania wstępne: Brak. Coreq: 7,492 [J] lub 7,493 [J] pozwolenie instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Wprowadza studentów na wydział uczestniczący w międzywydziałowym programie dla absolwentów Mikrobiologii poprzez serię trzech rotacji laboratoriów, które zapewniają szeroką ekspozycję na badania mikrobiologiczne na MIT. Studenci wybierają laboratorium do badań dyplomowych przed końcem pierwszego roku. Biorąc pod uwagę interdyscyplinarny charakter programu i wiele dostępnych programów badawczych, studenci mogą współpracować z więcej niż jednym opiekunem naukowym. Ograniczone do studentów studiów magisterskich z mikrobiologii.

7. Praca magisterska z mikrobiologii MTHG

Wymagania wstępne: Zgoda instruktora
G (jesień, IAP, wiosna, lato)
Jednostki ułożone
Można powtórzyć na kredyt.

Program badań prowadzących do napisania pracy doktorskiej. Do uzgodnienia przez studenta i odpowiedniego członka wydziału MIT.

Biologia

7.50 Metoda i logika w biologii molekularnej

Wymagania wstępne: Brak. Coreq: 7,51 i 7,52 lub pozwolenie instruktora
G (jesień)
4-0-8 jednostek

Logika, projektowanie eksperymentów i metody w biologii, wykorzystanie dyskusji literatury pierwotnej do rozpoznania zasad badań biologicznych przy dokonywaniu odkryć i testowaniu hipotez. We współpracy z wydziałem studenci stosują te zasady również do generowania potencjalnego projektu badawczego, prezentowanego zarówno w formie pisemnej, jak i ustnej. Ograniczone do absolwentów kursu 7.

I. Cheeseman, M. Hemann, J. Lees, D. Sabatini, F. Solomon, S. Vos

7.51 Zasady analizy biochemicznej

Wymagania wstępne: Zgoda instruktora
G (jesień)
6-0-6 jednostek

Podstawy biochemii, podkreślanie struktury, badania równowagi, kinetyka, informatyka, badania pojedynczych cząsteczek i projektowanie eksperymentów. Tematy obejmują wiązanie i specyficzność makrocząsteczek, fałdowanie i rozwijanie białek, układy allosteryczne, czynniki transkrypcyjne, kinazy, kanały i transportery błonowe oraz maszyny molekularne.

7.52 Genetyka dla absolwentów

Wymagania wstępne: Zgoda instruktora
G (jesień)
4-0-8 jednostek

Zasady i podejścia do analizy genetycznej, w tym genetyka dziedziczenia Mendla i genetyka prokariotyczna, genetyka drożdży, genetyka rozwojowa, neurogenetyka i genetyka człowieka.

H.R. Horvitz, C. Kaiser, E. Lander

7.540[J] Granice w biologii chemicznej

Ten sam temat co 5.54[J], 20.554[J]
Prereq: 5.07[J], 5.13, 7.06 i pozwolenie instruktora
G (jesień)
3-0-9 jednostek

Patrz opis w temacie 5.54[J].

L. Kiessling, M. Ramiona

7.546[J] Nauka i biznes biotechnologii

Ten sam temat co 15.480[J], 20.586[J]
Wymagania wstępne: Brak. Coreq: 15,401 pozwolenie instruktora
G (wiosna)
3-0-6 jednostek

Patrz opis pod tematem 15.480[J].

7.548[J] Postępy w bioprodukcji

Ten sam temat co 10.53[J]
Tester spotyka się z 7.458[J], 10.03[J]
Wymagania wstępne: Brak
G (wiosna druga połowa semestru)
1-0-2 jednostki

Seminarium dotyczy sposobu wytwarzania biofarmaceutyków, coraz ważniejszych klas farmaceutyków. Tematy obejmują od podstawowych bioprocesów, przez nowe technologie, po ekonomię bioprodukcji. Obejmuje również wpływ globalizacji na regulacje i podejścia do jakości, a także integralność łańcucha dostaw. Studenci przystępujący do wersji magisterskiej wykonują dodatkowe zadania.

J. C. Love, A. Sinskey, S. Springs

7.549[J] Studia przypadków i strategie odkrywania i opracowywania leków

Ten sam temat co 15.137[J], 20.486[J], HST.916[J]
Wymagania wstępne: Brak
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
2-0-4 jednostki

Patrz opis pod tematem 20.486 [J].

7.55 Studia przypadków w nowoczesnym projektowaniu eksperymentalnym

Wymagania wstępne: Zgoda instruktora
G (wiosna)
2-0-7 jednostek

Koncentruje się na zwiększeniu zdolności uczniów do analizowania, projektowania i prezentowania eksperymentów, kładąc nacisk na nowoczesne techniki. Dyskusje klasowe rozpoczynają się artykułami, które rozwinęły lub wykorzystały współczesne podejścia (np. mikroskopię ilościową, biofizyczne i molekularne metody genetyczne) w celu rozwiązania ważnych problemów w biologii. Każdy uczeń przygotowuje jeden konkretny cel standardowej propozycji badawczej dla projektu, który kładzie nacisk na strategię badawczą, projektowanie eksperymentalne i pisanie.

L. Guarente, S. Spranger

7.571 Analiza ilościowa danych biologicznych (nowe)

Wymagania wstępne: Brak
G (wiosna pierwsza połowa semestru)
2-0-4 jednostki

Zastosowanie teorii prawdopodobieństwa i metod statystycznych do analizy danych biologicznych. Tematyka obejmuje: statystykę opisową i inferencyjną, wprowadzenie do statystyki bayesowskiej, projektowanie eksperymentów ilościowych oraz metody analizy wielowymiarowych zbiorów danych. Podkreśla się <em>konceptualne</em> rozumienie tematów, a metody są ilustrowane przy użyciu języka programowania Python. Chociaż zachęca się do podstawowej znajomości języka Python, nie jest wymagane żadne doświadczenie w programowaniu. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

7.572 Pomiary ilościowe i modelowanie systemów biologicznych (nowe)

Wymagania wstępne: Brak
G (wiosna druga połowa semestru)
2-0-4 jednostki

Ilościowe projektowanie eksperymentów, analiza danych i modelowanie systemów biologicznych. Tematy obejmują bezwzględną/względną kwantyfikację, szum i odtwarzalność, regresję i korelację oraz modelowanie wzrostu populacji, ekspresję genów, dynamikę komórkową, regulację sprzężenia zwrotnego, oscylacje. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

7.573 Nowoczesna biostatystyka (nowość)

Temat spotyka się z 7.093
Wymagania wstępne: 7.03 i 7.05
G (wiosna pierwsza połowa semestru)
2-0-4 jednostki

Zawiera wprowadzenie do prawdopodobieństwa i statystyki stosowanej we współczesnej biologii. Dyskretne i ciągłe rozkłady prawdopodobieństwa, modelowanie statystyczne, testowanie hipotez, statystyka bayesowska, niezależność, prawdopodobieństwo warunkowe, łańcuchy Markowa, metody wizualizacji danych, grupowanie, analiza głównych składowych, metody nieparametryczne, symulacje Monte Carlo, współczynnik fałszywych odkryć. Zastosowania w genomice genetyki analizy DNA, RNA i sekwencji białek. Praca domowa obejmuje język programowania R, ale wcześniejsze doświadczenie w programowaniu nie jest wymagane. Studenci zarejestrowani do wersji magisterskiej realizują dodatkowy projekt, stosując metody biostatystyczne do danych ze swoich badań.

7.574 Współczesna biologia obliczeniowa (nowość)

Temat spotyka się z 7.094
Wymagania wstępne: 7.03 i 7.05
G (wiosna druga połowa semestru)
2-0-4 jednostki

Wprowadza nowoczesne metody w biologii obliczeniowej, koncentrując się na analizie sekwencji DNA/RNA/białek. Tematy obejmują sekwencjonowanie DNA nowej generacji i analizę danych sekwencjonowania, sekwencjonowanie RNA (masowe i jednokomórkowe), profilowanie rybosomów i proteomikę. Studenci zarejestrowani do wersji magisterskiej realizują dodatkowy projekt, stosując metody bioinformatyczne do danych ze swoich badań.

7.58 Biologia molekularna

Temat spotyka się z 7.28
Prereq: 7.03, 7.05 i pozwolenie instruktora
G (wiosna)
5-0-7 jednostek

Szczegółowa analiza mechanizmów biochemicznych kontrolujących utrzymanie, ekspresję i ewolucję genomów prokariotycznych i eukariotycznych. Tematy poruszane na wykładzie i lektury odpowiedniej literatury obejmują: regulację genów, replikację DNA, rekombinację genetyczną i translację mRNA. Podkreślono logikę projektowania eksperymentów i analizy danych. Prezentacje obejmują zarówno wykłady, jak i dyskusje grupowe reprezentatywnych artykułów z literatury. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

7.59[J] Nauczanie nauk ścisłych i inżynieryjnych na poziomie college'u

Ten sam temat co 1,95[J], 5,95[J], 8,395[J], 18,094[J]
Temat spotyka się z 2.978
Wymagania wstępne: Brak
Rok Acad 2020-2021: Nieoferowany
Acad Rok 2021-2022: G (jesień)
2-0-2 jednostki

Patrz opis w temacie 5.95[J].

7.60 Biologia komórki: struktura i funkcje jądra komórkowego

Prereq: 7.06 lub pozwolenie instruktora
G (wiosna)
3-0-9 jednostek

Struktura, funkcja i ekspresja genomu eukariotycznego, przetwarzanie RNA i regulacja cyklu komórkowego. Nacisk na techniki i logikę stosowaną do rozwiązywania ważnych problemów w biologii komórki jądrowej. Wykłady na szerokie tematy z biologii komórki jądrowej i dyskusje na temat reprezentatywnych artykułów z ostatnich lat.

7.61[J] Biologia komórki eukariotycznej: zasady i praktyka

Ten sam temat co 20.561[J]
Wymagania wstępne: Zgoda instruktora
G (jesień)
4-0-8 jednostek

Podkreśla metody i logikę stosowaną do analizy struktury i funkcji komórek eukariotycznych w różnych układach (np. drożdże, muchy, robaki, myszy, rozwój człowieka, komórki macierzyste, neurony). Łączy wykłady i pogłębione dyskusje okrągłego stołu na temat lektur literatury z aktywnym udziałem ekspertów wydziałowych. Zajmuje się błonami (struktura, funkcja, ruch), organellami, powierzchnią komórki, transdukcją sygnału, cytoszkieletem, ruchliwością komórki i macierzą pozakomórkową. Sięga od badań podstawowych po zastosowania w chorobach człowieka, kładąc nacisk na krytyczną analizę podejść eksperymentalnych. Zapisy ograniczone.

7.62 Fizjologia drobnoustrojów

Temat spotyka się z 7.21
Prereq: 7.03, 7.05 i pozwolenie instruktora
G (jesień)
4-0-8 jednostek

Właściwości biochemiczne bakterii i innych mikroorganizmów umożliwiające im rozwój w różnych warunkach. Interakcja między bakteriami a bakteriofagami. Genetyczna i metaboliczna regulacja działania i tworzenia enzymów. Budowa i funkcja składników bakteryjnej otoczki komórkowej. Wydzielanie białka ze szczególnym uwzględnieniem jego różnych ról w patogenezie. Dodatkowe tematy obejmują bioenergetykę, symbiozę, wykrywanie kworum, globalne reakcje na uszkodzenia DNA i biofilmy. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

G. C. Walker, A. J. Sinskey

7,63[J] Immunologia

Ten sam temat co 20.630[J]
Tester spotyka się z 7.23[J], 20.230[J]
Prereq: 7.06 i pozwolenie instruktora
G (wiosna)
5-0-7 jednostek

Kompleksowy przegląd molekularnych, genetycznych i komórkowych aspektów układu odpornościowego. Tematyka obejmuje wrodzoną i nabytą odporność komórki i narządy układu odpornościowego hematopoeza immunoglobulina, receptor limfocytów T i rozwój białek i genów głównego układu zgodności tkankowej (MHC) oraz funkcje limfocytów B i T odpowiedzi immunologiczne na infekcje i nowotwory nadwrażliwość, autoimmunizacja i niedobory odporności . Szczególna uwaga na rozwój i funkcjonowanie układu odpornościowego jako całości, badanego nowoczesnymi metodami i technikami. Studenci wybierający wersję magisterską zgłębiają temat, w tym studiują najnowszą literaturę podstawową.

S. Spranger, M. Birnbaum

7.64 Mechanizmy molekularne, patologia i terapia ludzkich zaburzeń nerwowo-mięśniowych

Wymagania wstępne: Zgoda instruktora
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
3-0-9 jednostek

Bada podstawy molekularne i kliniczne zaburzeń ośrodkowego układu nerwowego i nerwowo-mięśniowego ze szczególnym uwzględnieniem strategii interwencji terapeutycznej. Rozważa dogłębną analizę cech klinicznych, mechanizmów patologicznych i odpowiedzi na aktualne interwencje terapeutyczne. Obejmuje choroby neurodegeneracyjne, takie jak choroba Huntingtona, choroba Parkinsona, choroba Alzheimera, stwardnienie zanikowe boczne, otępienie czołowo-skroniowe oraz zaburzenia nerwowo-mięśniowe, takie jak dystrofia miotoniczna, dystrofia twarzoczaszki i dystrofia mięśniowa Duchenne'a.

7.65[J] Rdzeń neuronauki molekularnej i komórkowej I

Ten sam temat co 9.015[J]
Wymagania wstępne: Brak
G (jesień)
3-0-9 jednostek

Patrz opis w temacie 9.015[J].

7.66 Molekularne podstawy choroby zakaźnej

Temat spotyka się z 7.26
Prereq: 7.06 i pozwolenie instruktora
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
4-0-8 jednostek

Koncentruje się na zasadach interakcji gospodarz-patogen ze szczególnym uwzględnieniem chorób zakaźnych człowieka. Przedstawia kluczowe pojęcia patogenezy poprzez badanie różnych patogenów człowieka. Zawiera krytyczną analizę i omówienie przypisanych lektur. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

7.68[J] Rdzeń neuronauki molekularnej i komórkowej II

Ten sam temat co 9.013[J]
Wymagania wstępne: Zgoda instruktora
G (wiosna)
3-0-9 jednostek

Patrz opis w temacie 9.013[J].

7.69[J] Neurobiologia rozwojowa

Ten sam temat co 9.181[J]
Tester spotyka się z 7.49[J], 9.18[J]
Prereq: 9.011 lub pozwolenie instruktora
G (wiosna)
3-0-9 jednostek

Patrz opis pod tematem 9.181[J].

7.70 Regulacja ekspresji genów

Wymagania wstępne: Zgoda instruktora
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
4-0-8 jednostek

Seminarium omawia podstawowe zasady biologicznej regulacji ekspresji genów. Koncentruje się na przykładach, które leżą u podstaw tych zasad, a także na tych, które kwestionują pewne od dawna utrzymywane poglądy. Poruszone tematy mogą obejmować rolę czynników transkrypcyjnych, wzmacniaczy, modyfikacji DNA, niekodujących RNA i struktury chromatyny w regulacji ekspresji genów oraz mechanizmów epigenetycznego dziedziczenia stanów transkrypcyjnych. Ograniczony do 40.

7.71 Technika biofizyczna

Temat spotyka się z 5.78
Prereq: 5.13, 5.60, (5.07[J] lub 7.05) i pozwolenie instruktora
G (wiosna)
5-0-7 jednostek

Wprowadza studentów w nowoczesne metody biofizyczne do badania układów biologicznych od skali atomowej, molekularnej i komórkowej. Obejmuje dogłębną dyskusję na temat technik obejmujących pełny zakres rozdzielczości, w tym krystalografię rentgenowską, mikroskopię elektronową i świetlną. Omówiono inne popularne techniki biofizyczne do charakteryzacji makromolekularnych. Wykłady obejmują teoretyczne podstawy technik, a studenci otrzymują praktyczne ćwiczenia laboratoryjne z wykorzystaniem oprzyrządowania dostępnego w MIT. Spełnia 5,78, gdy jest oferowane jednocześnie.

7.72 Komórki macierzyste, regeneracja i rozwój

Wymagania wstępne: Zgoda instruktora
G (wiosna)
4-0-8 jednostek

Tematyka obejmuje różnorodne komórki macierzyste, takie jak komórki macierzyste mięśni, jelit, skóry, włosów i hematopoetyczne, a także pluripotencjalne komórki macierzyste. Tematy dotyczą polaryzacji komórek i informacji o położeniu losu komórek oraz wzorców rozwoju i regeneracji regeneracji kończyn, serca i całego ciała komórek macierzystych odnowy komórek macierzystych w odpowiedziach rozwojowych na zranienia oraz zastosowań komórek macierzystych w opracowywaniu terapii. Uzupełnieniem wykładów są omówienia referatów.

7.73 Zasady biologii chemicznej

Prereq: 7.05 i pozwolenie instruktora
G (wiosna)
Nie oferowane regularnie konsultuj się z działem
3-0-9 jednostek

Obejmujące dziedziny biologii, chemii i inżynierii zajęcia omawiają zasady biologii chemicznej i jej zastosowanie metod chemicznych i fizycznych oraz odczynników do badania i manipulowania systemami biologicznymi. Tematy obejmują reakcje bioortogonalne i profilowanie białek oparte na aktywności, inhibitory małych cząsteczek i genetykę chemiczną, sondy fluorescencyjne do badań biologicznych oraz nienaturalną mutagenezę aminokwasów. Obejmuje również podejścia biologii chemicznej do badania dynamicznych potranslacyjnych reakcji modyfikacji, biosyntezy i mutasyntezy produktów naturalnych oraz wysokowydajnych badań przesiewowych leków. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

7.74[J] ​​Tematy w biofizyce i biologii fizycznej

Ten sam temat co 8.590[J], 20.416[J]
Wymagania wstępne: Brak
G (jesień)
Nie oferowane regularnie konsultuj się z działem
2-0-4 jednostki

Patrz opis pod tematem 20.416[J].

I. Cisse, N. Fakhri, M. Guo

7.76 Tematy w strukturze i funkcji makromolekularnej

Wymagania wstępne: Zgoda instruktora
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
3-0-6 jednostek

Dogłębna analiza i omówienie literatury klasycznej i aktualnej, ze szczególnym uwzględnieniem budowy, funkcji i mechanizmów białek i innych makrocząsteczek biologicznych.

7.77 Kwasy nukleinowe, struktura, funkcja, ewolucja i ich interakcje z białkami

Prereq: 7.05, 7.51 lub pozwolenie instruktora
G (wiosna)
3-0-9 jednostek

Przegląda literaturę podstawową, koncentrując się na biochemicznych, biofizycznych, genetycznych i kombinatorycznych podejściach do zrozumienia kwasów nukleinowych. Tematy obejmują ogólne właściwości, funkcje i motywy strukturalne DNA i RNA RNA jako katalizatorów i regulatorów ekspresji genów, edycji i nadzoru RNA oraz interakcji kwasów nukleinowych z białkami, takimi jak białka palca cynkowego, enzymy modyfikujące, aminoacylo- Syntetazy tRNA i inne białka maszynerii translacyjnej. Obejmuje kilka wykładów, ale w większości jest analizą i dyskusją na temat aktualnej literatury w kontekście prezentacji studenckich.

D. Bartel, U. RajBhandary

7.80 Podstawy biologii chemicznej

Tester spotyka się z 5.08[J], 7.08[J]
Wymagania wstępne: 5.13 i (5.07[J] lub 7.05)
G (wiosna)
4-0-8 jednostek

Obejmujące dziedziny biologii, chemii i inżynierii zajęcia te wprowadzają studentów w zasady biologii chemicznej oraz zastosowanie metod i odczynników chemicznych i fizycznych do badania i manipulowania systemami biologicznymi. Tematy obejmują strukturę kwasu nukleinowego, rozpoznawanie i manipulację fałdowaniem i stabilnością białek oraz proteostatyczne reakcje bioortogonalne i genetykę chemiczną profilowania białek w oparciu o aktywność oraz sondy fluorescencyjne do badań przesiewowych inhibitorów drobnocząsteczkowych do analizy i obrazowania biologicznego oraz mutagenezy nienaturalnych aminokwasów. Na zajęciach omówiona zostanie również logika dynamicznych reakcji modyfikacji potranslacyjnych z naciskiem na podejścia biologii chemicznej do badania złożonych procesów, w tym glikozylacji, fosforylacji i lipidacji. Od studentów biorących udział w wersji dla absolwentów oczekuje się głębszego zgłębienia tematu.

B. Imperiali, L. Kiessling, R. Raines

7.81[J] Biologia systemów

Ten sam temat co 8.591[J]
Tester spotyka się z 7.32
Prereq: (18.03 i 18.05) lub pozwolenie instruktora
G (jesień)
3-0-9 jednostek

Patrz opis pod tematem 8.591[J].

7.82 Tematy rozwoju ssaków i genetyki

Wymagania wstępne: Zgoda instruktora
Rok Acad 2020-2021: Nieoferowany
Rok Acad 2021-2022: G (wiosna)
3-0-9 jednostek

Seminarium poświęcone embriologicznym, molekularnym i genetycznym podejściom do rozwoju u myszy i ludzi. Tematy obejmują rozwój przedimplantacyjny, gastrulację embrionalnych komórek macierzystych, celowanie genowe i przeprogramowanie jądrowe komórek somatycznych, imprintowanie genomowe, określanie płci inaktywacji chromosomu X oraz komórki zarodkowe.

7.85 Znaki rozpoznawcze raka

Temat spotyka się z 7.45
Wymagania wstępne: Brak. Coreq: 7,06 pozwolenie instruktora
G (jesień)
4-0-8 jednostek

Zapewnia kompleksowe wprowadzenie do podstaw biologii raka i leczenia raka. Tematy obejmują genetykę raka, genomikę i epigenetykę, rodzinne zespoły nowotworowe, transdukcję sygnału, kontrolę cyklu komórkowego i apoptozę, metabolizm komórek macierzystych raka i przerzuty raka, immunologię i immunoterapię, konwencjonalne i ukierunkowane molekularnie terapie oraz wczesne wykrywanie i zapobieganie. Studenci przystępujący do wersji magisterskiej wykonują dodatkowe zadania.

T. Jacks, M. Vander Heiden

7.86 Budowanie z komórkami

Temat spotyka się z 7.46
Wymagania wstępne: 7.03 i 7.05
G (jesień)
4-0-8 jednostek

Koncentruje się na podstawowych zasadach biologii rozwoju, według których komórki budują organy i organizmy. Analizuje kluczową rolę komórek macierzystych w utrzymaniu lub naprawie tkanek oraz w leczeniu chorób. Bada, jak zintegrować tę wiedzę z narzędziami inżynierskimi do konstruowania funkcjonalnych struktur tkankowych. Studenci przystępujący do wersji magisterskiej wykonują dodatkowe zadania.

7.89[J] Zagadnienia w biologii obliczeniowej i systemowej

Ten sam temat co CSB.100[J]
Wymagania wstępne: Zgoda instruktora
G (jesień)
2-0-10 jednostek

Patrz opis pod tematem CSB.100[J]. Preferencja dla doktorantów pierwszego roku CSB.

7.930[J] Doświadczenie badawcze w Biopharma

Ten sam temat co 20.930[J]
Wymagania wstępne: Brak
G (wiosna)
2-10-0 jednostek

Patrz opis pod tematem 20.930[J].

7.931 Niezależne badanie biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Program studiów lub badań do uzgodnienia z pracownikiem wydziału.

7.932 Niezależne badania w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Jednostki ułożone
Można powtórzyć na kredyt.

Program studiów lub badań do uzgodnienia z pracownikiem wydziału.

7.933 Rotacje badawcze w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Wprowadza studentów na wydział uczestniczący w programie dla absolwentów biologii poprzez serię rotacji laboratoriów, które zapewniają szeroką ekspozycję na badania biologiczne na MIT. Studenci wybierają laboratorium do badań dyplomowych przed końcem pierwszego roku. Ograniczone do studentów studiów magisterskich z biologii.

7.934 Doświadczenie w nauczaniu biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Dla wykwalifikowanych studentów studiów magisterskich na kierunku Biologia zainteresowanych nauczaniem. Nauczanie w klasie lub laboratorium pod kierunkiem członka wydziału.

7.935 Odpowiedzialne postępowanie w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień)
Ułożone jednostki [P/D/F]

Sesje skupiają się na odpowiedzialnym prowadzeniu nauki. Rozważa prowadzenie dokumentacji i zgłaszanie ról mentora i podopiecznego, autorstwo, przegląd i poufność rozwiązywanie konfliktów, nadużycia i nadużycia, współpracę, sprzeczne interesy oraz własność intelektualną i właściwe praktyki w zakresie wykorzystywania zwierząt i ludzi. Ograniczone do studentów drugiego roku studiów podyplomowych z biologii.

7.936 Rozwój zawodowy w biologii

Wymagania wstępne: Brak
G (jesień, wiosna)
0-2-0 jednostek

Wymagane na kursie 7 doktorantów, aby uzyskać profesjonalną perspektywę w działaniach związanych z rozwojem kariery, takich jak staże, spotkania naukowe oraz wydarzenia związane z karierą i networkingiem. Pisemny raport wymagany po zakończeniu czynności.

7.941 Problemy badawcze

Wymagania wstępne: Zgoda instruktora
G (jesień, lato)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Kierowane badania w dziedzinie nauk biologicznych, ale nie przyczyniające się do pracy magisterskiej.

Skonsultuj się z Biurem Edukacji Biologicznej

7.942 Problemy badawcze

Wymagania wstępne: Zgoda instruktora
G (wiosna)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Kierowane badania w dziedzinie nauk biologicznych, ale nie przyczyniające się do pracy magisterskiej.

Skonsultuj się z Biurem Edukacji Biologicznej

7.95 Biologia raka

Prereq: 7.85 i pozwolenie instruktora
G (wiosna)
3-0-9 jednostek

Zaawansowane seminarium obejmujące intensywną analizę historycznych i aktualnych wydarzeń w biologii nowotworów. Tematy dotyczą zasad apoptozy, zasad biologii raka, genetyki raka, metabolizmu komórek nowotworowych, immunologii guza i terapii. Szczegółowa analiza literatury naukowej, w tym ważnych raportów opublikowanych w ostatnich latach. Zapisy ograniczone.

7.98[J] Plastyczność neuronalna w uczeniu się i pamięci

Ten sam temat co 9.301[J]
Wymagania wstępne: Zgoda instruktora
G (wiosna)
3-0-6 jednostek

Patrz opis pod tematem 9.301[J]. Juniorzy i seniorzy wymagają zgody instruktora.

7.S930 Przedmiot specjalny w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna, lato)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Obejmuje materiały z różnych dziedzin biologii, które nie są oferowane przez zwykłe przedmioty nauczania.

7.S931 Przedmiot specjalny w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, wiosna, lato)
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Obejmuje materiały z różnych dziedzin biologii, które nie są oferowane przez zwykłe przedmioty nauczania.

7.S932 Przedmiot specjalny w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, IAP, wiosna)
Nie oferowane regularnie konsultuj się z działem
Ułożone jednostki [P/D/F]
Można powtórzyć na kredyt.

Obejmuje materiały z różnych dziedzin biologii, które nie są oferowane przez zwykłe przedmioty nauczania.

7.S939 Przedmiot specjalny w biologii

Wymagania wstępne: Zgoda instruktora
G (jesień, IAP, wiosna)
Nie oferowane regularnie konsultuj się z działem
Jednostki ułożone
Można powtórzyć na kredyt.

Obejmuje materiały z różnych dziedzin biologii, które nie są oferowane przez zwykłe przedmioty nauczania.

7. Praca magisterska z biologii THG

Wymagania wstępne: Zgoda instruktora
G (jesień, IAP, wiosna, lato)
Jednostki ułożone
Można powtórzyć na kredyt.


Materiały i metody

Szczepy, podłoża i warunki wzrostu

S. cerevisiae szczep BY4741 (MATA a, jego3Δ, leu2Δ0, met15Δ0, ura0) użyto i hodowano w syntetycznej pełnej pożywce w 30°C. Komórki hodowano do gęstości 1 x 107 komórek na ml. Kultury zostały podzielone na dwie NaAsO2 (100 μM i 1 mM w dwóch powtórzeniach biologicznych) dodano do jednej hodowli i obie inkubowano w 30°C przez 0,5, 2 lub 4 godziny. Komórki osadzano i przemywano wodą destylowaną przed ekstrakcją RNA. Usunięcie szczepów (tak1Δ, cad1Δ, arr1Δ oraz rpn4Δ) o tym samym tle uzyskano z Research Genetics, potwierdzono i potraktowano w ten sam sposób, przez 2 godziny i 100 μM NaAsO2.

Ekstrakcja RNA

Do eksperymentów z hybrydyzacją cDNA, całkowity RNA wyizolowano stosując metodę kwasowo-fenolową. Osady ponownie zawieszono w 4 ml buforu do lizy (10 mM Tris-HCl pH 7,5, 10 mM EDTA, 0,5% SDS). Dodano cztery mililitry kwaśnego (nasyconego wodą, o niskim pH) fenolu, a następnie worteksowano. Roztwory komórek lizujących inkubowano w 65°C przez 1 godz. ze sporadycznym energicznym worteksowaniem, a następnie umieszczono na lodzie na 10 min przed wirowaniem w 4°C przez 10 min. Warstwy wodne ponownie wyekstrahowano fenolem (temperatura pokojowa, bez inkubacji) i wyekstrahowano raz chloroformem. Następnie dodano octan sodu do 0,3 M z 2 objętościami absolutnego etanolu, umieszczono w -20°C na 30 min, a następnie odwirowano. Osady przemyto dwa lub trzy razy 70% etanolem, a następnie oczyszczano Qiagen Poly(A) + RNA z etapem selekcji Oligotex oligo (dT). Całkowity RNA dla specyficznych szczepów nokautujących i doświadczenia rodzicielskiego wyizolowano za pomocą reakcji enzymatycznej, zgodnie z protokołem drożdży RNeasy (Qiagen).

Hybrydyzacje i analizy mikromacierzy

Do eksperymentów profilowania ekspresji genów użyto cDNA cDNA cDNA, opracowanego we własnym zakresie w Narodowym Instytucie Nauk o Zdrowiu Środowiskowym (NIEHS). Pełna lista ORF na tym chipie jest dostępna pod adresem [70]. Chipy mikromacierzy cDNA przygotowano jak opisano wcześniej [71, 72]. cDNA naniesiono jak opisano [73]. Każdą próbkę poli(A) RNA (2 μg) znakowano dUTP skoniugowanym z Cy3 lub Cy5 (Amersham) w reakcji odwrotnej transkrypcji przy użyciu odwrotnej transkryptazy SuperScript (Invitrogen) i startera oligo(dT) (Amersham). Hybrydyzacje i analizę przeprowadzono jak opisano Hewitt i inni. [74] z wyjątkiem tego, że geny o znormalizowanych wartościach intensywności stosunku poza 95-procentowym przedziałem ufności uznano za istotnie różnie wyrażane. Listy genów o zróżnicowanej ekspresji zostały zdeponowane w bazie danych NIEHS MAPS [75]. Geny, które ulegały zróżnicowanej ekspresji w co najmniej trzech z czterech powtórzeń eksperymentów, zostały skompilowane, a następnie pogrupowane przy użyciu oprogramowania Cluster/Treeview [76]. GeneSpring (Silicon Genetics) i Cytoscape [28] zostały wykorzystane do dalszej analizy i wizualizacji danych.

Eksperymenty z nokautem prowadzono na platformie z macierzą oligo drożdży Agilent. Próbki 10 μg całkowitego RNA znakowano stosując protokół zestawu do bezpośredniego znakowania fluorescencyjnego Agilent i hybrydyzacje prowadzono przez 16 godzin w obrotowym piecu do hybrydyzacji, stosując protokół przetwarzania Agilent 60-mer oligo microarray. Szkiełka zostały umyte zgodnie z zaleceniami i zeskanowane skanerem Agilent. Dane zostały zebrane przy użyciu oprogramowania do ekstrakcji cech Agilent, przy użyciu wartości domyślnych dla wszystkich parametrów, z zachowaniem warunków proporcji. Aby uwzględnić użycie protokołu etykiety bezpośredniej, warunki błędu zmieniono na: błąd multiplikatywny Cy5 = 0,15 błąd multiplikatywny Cy3 = 0,25 błąd addytywny Cy5 = 20 błąd addytywny Cy3 = 20.

Pliki i obrazy GEML zostały wyeksportowane z oprogramowania do ekstrakcji cech Agilent i zdeponowane w Rosetta Resolver (wersja 3.2, kompilacja 3.2.2.0.33) (Rosetta Biosoftware). Dwie macierze dla każdej pary próbek, w tym odwrócenie fluoru, połączono w eksperymenty proporcji w Rosetta Resolver. Wykresy intensywności zostały wygenerowane dla każdego eksperymentu proporcjonalnego, a geny uznano za „geny sygnatury”, jeśli P-wartość była mniejsza niż 0,001. P-wartości zostały obliczone przy użyciu modelu błędu Rosetta Resolver z warunkami błędu Agilent. Geny sygnaturowe analizowano za pomocą GeneSpring. Cały zestaw danych wewnętrznych i opartych na Agilent jest dostępny w plikach danych dodatkowych.

Wzbogacenie ontologii

Geny zostały wcześniej podzielone na różne ontologie i ścieżki. Jeśli konkretna ścieżka jest wzbogacona o geny, które ulegają znaczącej ekspresji w odpowiedzi na proces, dochodzimy do wniosku, że szlak prawdopodobnie będzie zaangażowany w ten proces. W sumie 829 genów z 6240 wykazywało znaczącą zmianę ekspresji w co najmniej jednym stanie eksperymentalnym. Wraz z wielkością każdej kategorii funkcjonalnej obliczono statystyczną miarę istotności wzbogacenia za pomocą testu hipergeometrycznego. Poziom istotności dla tego testu wyznaczono stosując poprawkę Bonferroniego, gdzie wartość α ustalono na 0,05, a liczba testów przeprowadzonych dla szlaku KEGG i uproszczonej ontologii genów (proces biologiczny) wyniosła odpowiednio 27 i 11.

Wyszukiwanie w sieci

Algorytm ActiveModules został wykorzystany do identyfikacji sąsiedztw w sieci regulacyjnej odpowiadających znaczącym poziomom ekspresji różnicowej. W tym wyszukiwaniu, jeśli białko ma wielu sąsiadów, prawdopodobne jest, że losowo kilka z nich wykaże znaczące zmiany w ekspresji i mogą one zostać wybrane jako znacząca podsieć. Punktacja sąsiedztwa to metoda, której użyliśmy do skorygowania tego błędu. W tym schemacie znacząca podsieć musi zawierać albo wszystkich sąsiadów każdego białka, albo żadnego z nich. Znaczenie reprezentuje wówczas agregat nad wszystkimi sąsiadami białka. Zapobiega to tendencyjnej selekcji kilku najlepiej ocenianych białek z dużego sąsiedztwa w poszukiwaniu znaczących podsieci. Szczegółowy opis tego algorytmu znajduje się w Ideker i inni. [1].

Definiując sieć stosowaną w analizie metabolicznej, wyeliminowano krawędzie odpowiadające metabolitom łączącym ponad 175 reakcji. Wyklucza to kofaktory metaboliczne, takie jak ATP, NADH i H2O z poszukiwań. Wyniki dla każdej ORF zostały wygenerowane przez mapowanie wartości istotności przydatności do wyniku Z. Aby przypisać wyniki do poszczególnych reakcji, mapowanie Förstera z ORF do reakcji zostało wykorzystane do wygenerowania listy ORF dla każdej reakcji. Wyniki Z tych ORF zostały następnie zagregowane w pojedynczy wynik dla tej reakcji przy użyciu następującego równania:

Użyliśmy algorytmu programowania dynamicznego zaadaptowanego z Kelley i inni. [77] w celu identyfikacji ścieżek o wysokich wynikach w tej sieci. Krótko mówiąc, ścieżka o najwyższej punktacji (n(n - 1) kończący się na sąsiednim węźle według następującego wzoru:

Ponieważ węzeł z wieloma sąsiadami z większym prawdopodobieństwem przynależy do ścieżki o wysokiej punktacji przez przypadek losowy, wynik sąsiedniej ścieżki jest korygowany względem statystyki wartości ekstremalnych z liczbą obserwacji równą liczbie sąsiadów.

Istotności sieci o najwyższej punktacji określono przez porównanie z rozkładem sieci o najwyższej punktacji z danych losowych (oceny reakcji losowane względem węzłów sieci). Po uruchomieniu algorytmu znajdowania/oceniania ścieżki, wynik pojedynczej ścieżki o najwyższym wyniku został dodany do rozkładu zerowego. Proces ten powtórzono dla 10 000 interakcji. Ten rozkład zerowy został następnie wykorzystany do określenia empirycznego P-wartość, która reprezentuje hipotezę zerową, że nie ma istotnej korelacji między topologią sieci metabolicznej a przypisaniem wartości istotności do węzłów w tej sieci.

Specyficzny filtr eksperymentu usuwania przy porównaniach fałd i zmian

Wykresy intensywności wygenerowano z każdego eksperymentu w Rosetta Resolver. Gen był uważany za gen sygnaturowy, jeśli P- wartość była mniejsza niż 0,001 i jeśli wartość krotności zmiany była większa lub równa dwukrotności. Geny sygnaturowe były następnie transmitowane na wykresie intensywności i eksportowane jako pliki tekstowe. Listy zostały zaimportowane do GeneSpring. Do porównania kontroli rodzicielskiej z eksperymentem rodzicielskim AsIII dla każdego eksperymentu z delecją (AsIII) zastosowano funkcję „Filtr po zmianie stopnia”. Lista genów wybrana dla każdego filtra w analizie zmiany krotności była kombinacją listy genów sygnatury rodzicielskiej i listy genów sygnatury delecji traktowanej AsIII, która była wówczas analizowana. Na przykład, jeśli dokonywano porównania pomiędzy rodzicami (traktowanymi AsIII) i Yap1 (traktowanymi AsIII), lista stosowana w analizie była kombinacją genów sygnatury rodzicielskiej i genów sygnatur Yap1. Filtr funkcji zmiany krotności raportuje geny, które zostały wybrane z jednego stanu (rodzic), które miały znormalizowane wartości danych, które były większe lub mniejsze niż te w innym stanie (badanie usunięcia) przez czynnik dwukrotny. Każda uzyskana lista genów została zapisana. Wszystkie powstałe listy genów zostały połączone, a lista genów z adnotacjami została wyeksportowana do użycia w pakiecie Eisen's Cluster/Treeview (opisanym wcześniej). Formatem eksportowanych danych był log naturalny. Drzewo genów wygenerowane dla artykułu zostało wygenerowane w GeneSpring. Każdy filtr przy zmianie fałdów został zapisany jako lista genów z adnotacjami.

Generowanie konkretnych „list minus” eksperymentu usuwania

Listy genów sygnatury generowano w Rosetta Resolver z wykresów intensywności, jak opisano powyżej. Każda lista genów sygnatury została zapisana jako „Bioset” w Resolverze. Macierzysty Bioset został porównany z każdym delecyjnym Biosetem przy użyciu funkcji „Minus”. Ta funkcja znajduje tych członków w grupie Bioset 1 (rodzic), którzy nie istnieją w grupie Bioset 2 (skreślenie). Każda z otrzymanych list została zapisana jako nowy Bioset. Nowy „minus” Bioset został wyemitowany na odpowiadającym mu wykresie intensywności i wyeksportowany jako plik tekstowy. Powtórzono to dla każdego eksperymentu, dostrajając dane za pomocą GeneSpring.

Profilowanie fenotypowe

Homozygotyczne szczepy z delecją diploidalną i łączenie szczepów przeprowadzono zgodnie z opisem [66]. Próbki hodowano do fazy logarytmicznej, rozcieńczano do OD600 0,05-0,1, podzielić na probówki i potraktować arsenem przez 1-2 godziny w stężeniach 1 mM, 2 mM i 5 mM. Podobne odpowiedzi zaobserwowano przy każdym stężeniu, więc wyniki połączono. Te hodowle i próbkę traktowaną próbnie utrzymywano w fazie wzrostu logarytmicznego przez okresowe rozcieńczanie przez 16-18 godzin. Sekwencje UPTAG i DOWNTAG amplifikowano oddzielnie z genomowego DNA leku i próbek traktowanych próbnie metodą PCR z użyciem starterów znakowanych biotyną, jak opisano wcześniej [66]. Produkty amplifikacji połączono i hybrydyzowano z macierzami Tags3 (Affymetrix). Procedury amplifikacji PCR, hybrydyzacji i skanowania wykonano zgodnie z opisem [66] i zgodnie z zaleceniami producenta, jeśli dotyczyło. Obrazy oznaczono ilościowo przy użyciu oprogramowania Affymetrix Microarray Suite. Wartości UPTAG i DOWNTAG zostały oddzielnie znormalizowane, proporcjonalne (sygnał próbki poddanej obróbce/kontrola) i przefiltrowane pod kątem intensywności powyżej tła [78].


Odkrycie na dużą skalę i charakterystyka motywów regulatorowych białek u eukariontów

Rosnąca zdolność do generowania wielkoskalowych, ilościowych danych proteomicznych wiązała się z wyzwaniem analizy takich danych w celu odkrycia elementów sekwencji, które leżą u podstaw zachowania białek na poziomie systemów. Tutaj pokazujemy, że krótkie, liniowe motywy białkowe można skutecznie odzyskać z zestawów danych w skali proteomu, takich jak lokalizacja subkomórkowa, funkcja molekularna, okres półtrwania i dane o obfitości białka przy użyciu podejścia opartego na teorii informacji. Stosując to podejście, zidentyfikowaliśmy wiele znanych motywów białkowych, takich jak miejsca fosforylacji i sygnały lokalizacyjne, i odkryliśmy dużą liczbę elementów kandydujących. Szacujemy, że

80% z nich to nowe przewidywania, ponieważ nie pasują do znanego motywu zarówno w kontekście sekwencji, jak i biologicznym, co sugeruje, że potranslacyjna regulacja zachowania białek jest nadal w dużej mierze niezbadana. Te przewidywane motywy, z których wiele wykazuje preferencyjne powiązanie z określonymi szlakami biologicznymi i nielosowym pozycjonowaniem w liniowej sekwencji białkowej, dostarczają ukierunkowanych hipotez do walidacji eksperymentalnej.

Oświadczenie o konflikcie interesów

Konkurencyjne interesy: Autorzy oświadczyli, że nie istnieją sprzeczne interesy.


Wstęp

W ewolucji eukariotycznej względne znaczenie horyzontalnego transferu genów (HGT) w porównaniu z innymi źródłami nowości genetycznych (tj. duplikacją genów, modyfikacją i powstawaniem de novo) jest nierozstrzygniętym tematem. Jest to w przeciwieństwie do Bacteria i Archaea, wśród których HGT jest głównym motorem innowacji genetycznych (Ochman i in. 2000 Pál i in. 2005 Treangen i Rocha 2011). Chociaż wpływ HGT na ewolucję eukariotów pozostaje słabo scharakteryzowany, HGT jest zaangażowany w eksploatację nowych nisz przez kilka grup drobnoustrojów, w tym apikompleksy (Striepen i wsp. 2004), rzęski (Ricard i wsp. 2006), diplomonady (Andersson i wsp.) al. 2003) oraz grzyby (Slot i Hibbett 2007). Zatem HGT może być znaczącym motorem innowacji genów przynajmniej w niektórych liniach eukariotycznych (Keeling i Palmer 2008 Andersson 2009). Jednak słaba rozdzielczość u podstawy eukariotycznego drzewa życia, a także niedobór danych sekwencyjnych nowej generacji z drobnoustrojów eukariotycznych komplikuje interpretację filogenezy genów sugerujących HGT (przegląd w Stiller 2011, patrz np. Chan et al. 2012 Curtis i wsp. 2012 Deschamps i Moreira 2012).

Chociaż pomiar i interpretacja HGT u eukariontów pozostają wyzwaniami, transfer genów podczas ewolucji mitochondriów i plastydów (tj. endosymbiozy) jest dobrze znanym mechanizmem transferu genów, procesem określanym jako transfer genów endosymbiotycznych (EGT). Pierwotny plastyd Archaeplastida (tj. glonów czerwonych, zielonych i glaukofitowych, Adl i wsp. 2005) powstał w wyniku endosymbiotycznego powiązania między sinicami a heterotroficznym, eukariotycznym gospodarzem ( Douglas 1998).Powstałe organelle fotosyntetyczne, plastyd, utrzymują zredukowany genom o ≤200 genów, ale większość genów wymaganych do fotosyntezy została przeniesiona do genomu jądrowego gospodarza alg (Martin i Herrmann 1998). Wiele z tych przeniesionych genów jest kierowanych z powrotem do plastydu, ale niektóre zostały dokooptowane do funkcjonowania w nowych procesach, a tym samym zwiększają potencjał genetyczny genomu gospodarza (Martin i Herrmann 1998). Plastydowe endosymbiozy angażujące eukariotyczne endosymbioty alg, a nie cyjanobakterie, dalej rozprowadzały plastydy i geny niezbędne do ich utrzymania w całym eukariotycznym drzewie życia (Archibald 2009).

Innym możliwym trybem HGT u drobnoustrojowych eukariontów jest pozyskiwanie materiału genetycznego podczas połykania zdobyczy (Doolittle 1998), co jest poparte opisami HGT w fagotroficznych liniach, takich jak orzęski (Ricard i wsp. 2006), euglenidy (Maruyama i wsp. 2011). ) i amebea (Eichinger i wsp. 2005). Dalsze wsparcie dla modelu połykania zdobyczy pochodzi z alg (niemonofiletyczna grupa fotosyntetycznych, zawierających plastyd eukariontów). Chociaż pierwotne organizmy zawierające plastydy są ścisłymi autotrofami, z kilkoma wyjątkami, wiele glonów z plastydami pochodzącymi z dodatkowych endosymbioz (np. euglenidy i bruzdnice) to miksotrofy, które uzupełniają fotosyntezę poprzez spożywanie cząstek pokarmu (Stoecker 1998). W przypadku tych glonów miksotroficznych hipoteza połknięcia zdobyczy przewiduje, że organizmy te będą miały geny nabyte zarówno z ich plastydu, jak i zdobyczy (Doolittle 1998).

Bruzdnice to protisty (tj. mikrobiologiczne eukarionty) powszechne w wielu środowiskach wodnych i są idealnymi organizmami do badania wpływu HGT na ewolucję eukariotyczną. Wiele gatunków bruzdnic to miksotrofy, które mają zdolność pozyskiwania węgla z fotosyntezy, a także ze spożycia innych fitoplanktonu i bakterii (Hackett, Anderson i wsp. 2004). Na poparcie modelu połykania zdobyczy, poprzednie prace sugerują, że jądrowe genomy bruzdnic zawierają dużą liczbę genów nabytych w wyniku endosymbiozy plastydowej, jak również genów nabytych horyzontalnie z innych źródeł ( Hackett i in. 2005, 2013 Nosenko i in. 2006 Nosenko i Bhattacharya 2007 Janouskovec i wsp. 2010 Minge i wsp. 2010 Wisecaver i Hackett 2010 Stuken i wsp. 2011 Chan i wsp. 2012 Orr i wsp. 2013). Umiejscowienie bruzdnic jest rozwiązane i dobrze poparte w analizach filogenetycznych, co jest niezbędne do wnioskowania HGT na podstawie niezgodności filogenetycznej między drzewami genowymi i gatunkowymi. Dinoflagellates są siostrą Perkinsidae, grupy pasożytniczej, która obejmuje patogen ostryg Perkinsus marinus (Reece i wsp. 1997). Dinoflagellates i Perkinsidae razem są siostrą apikompleksów, wyłącznie pasożytniczej grupy odpowiedzialnej za wiele ludzkich chorób, w tym malarię i toksoplazmozę (Fast et al. 2002). Najbliższą główną grupą protist do bruzdnic i apikompleksów są orzęski, a te trzy linie razem są głównymi członkami superphylum Alveolata (Adl et al. 2005). Badania filogenetyczne sugerują, że pęcherzyki płucne są spokrewnione z stramenopiles (np. okrzemki i olbrzymie wodorosty) i ryzarzy (np. otwornice i radiolarians), stowarzyszenie określane skrótem jako supergrupa stramenopil-alveolate-rhizaria (SAR) ( Burki i wsp. 2007 Parfrey i in. 2010). Jednak pomimo tego rozwiązania filogenetycznego, jak również opublikowanych przypadków transferu genów, pełny zakres, czas i konsekwencje HGT w bruzdnicach pozostają nieznane, ponieważ przykładowe genomy nie zostały jeszcze zsekwencjonowane.

Genomy bruzdnic mają rozmiar od 1,5 do 185 Gbp (0,8 do ponad 60 razy większy od ludzkiego genomu) i są bogate w niekodujące sekwencje, tandemowe powtórzenia genów i inne niezwykłe cechy, które sprawiają, że sekwencjonowanie genomu przy użyciu obecnej technologii jest wysoce niepraktyczne przy obecnym montażu technologia (Wisecaver i Hackett 2011). Na szczęście sekwencjonowanie transkryptomu jest alternatywnym podejściem do pytań wymagających kompleksowego odkrycia genów w organizmach niemodelowych o złożonych genomach. Tutaj analizujemy kompleksowy montaż transkryptomu de novo dla bruzdnicy, Tamarense aleksandryjskie szczep CCMP1598, członek kladu „Grupy IV” w obrębie A. tamarense kompleks gatunkowy. Ten kompleks gatunkowy składa się z pięciu takich grup kladowych, z których każda prawdopodobnie reprezentuje odrębny gatunek kryptyczny ( Lilly et al. 2007). Odwołujemy się do naszych A. tamarense Zestaw genów grupy IV do danych znaczników transkryptomicznych i ekspresji sekwencji (EST) z 21 dodatkowych gatunków bruzdnic (w tym zespoły transkryptomów z A. tamarense Szczepy grupy I i grupy III) w celu uzyskania ostatecznego zestawu jednogenowego bruzdnicy, który następnie porównamy z 16 innymi genomami alg i protistów. Korzystając z rekonstrukcji zawartości genów przodków, mapujemy pozyskanie genów na drzewie ewolucyjnym pęcherzyków i weryfikujemy wyniki za pomocą potoku filogenomicznego. To połączone podejście oferuje solidną, porównawczą eksplorację wzorca HGT u bruzdnic w porównaniu z innymi eukariontami.


Dyskusja

Na przykład metabolizm ośrodkowy i aminokwasowy w B. subtilis, pokazujemy, że profilowanie fluxomu za pomocą wielowymiarowych statystyk z analizy rozkładu izotopomerów masy ma znaczenie dla rozróżniania mutantów lub stanów na podstawie ich zachowania metabolicznego i ma zastosowanie do warunków, które są niedostępne dla poprzedniej analizy strumienia. W przeciwieństwie do danych dotyczących stężenia metabolomów [24, 25], profile fluksomów zawierają informacje funkcjonalne dotyczące działania w pełni zmontowanych sieci [1, 4]. Jak pokazano tutaj przez ICA, podejście to umożliwia nam destylację podstawowych sygnatur niezależnych aktywności metabolicznych i wspiera identyfikację przyczyn biochemicznych leżących u ich podstaw. Ponieważ nie ma modelu lub apriorycznie wymagana jest wiedza na temat badanego układu, metaboliczne odciski dowolnego atomu i cząsteczki znacznika można śledzić praktycznie w każdym układzie biologicznym, w tym organizmach wielokomórkowych w złożonych podłożach wielosubstratowych.

Podobnie, apriorycznie znajomość liczby układów scalonych do obliczenia nie jest warunkiem wstępnym. W rzeczywistości optymalna liczba zależy przede wszystkim od wzorców etykietowania i trudno ją oszacować na podstawie wymiarów zestawu danych. Niedoszacowanie generalnie pozostawi niektóre istotne sygnatury nierozpoznane, podczas gdy przeszacowanie doprowadzi do zwiększonego udziału składników odzwierciedlających pomiary lub szum biologiczny. Chociaż istotność statystyczną można ocenić za pomocą duplikatów, staje się to niemożliwe w przypadku dużych zestawów danych (tj. setek mutantów lub analitów) lub ograniczonej dostępności replik. Wąskim gardłem jest podejście stochastyczne większości algorytmów ICA, dla których niezależne przebiegi skutkują różnymi układami scalonymi lub ich uporządkowaniem. Zamiast tego wiarygodność algorytmiczną i statystyczną układów scalonych można ocenić, powtarzając estymację kilka razy z losowo wybranymi wstępnymi domysłami lub odpowiednio nieznacznie zmieniając zbiór danych (bootstrapping [28]), a następnie grupując wszystkie wyniki w celu zidentyfikowania solidnych układów scalonych [29]. ].

Dwa czynniki bezpośrednio wpływają na wyniki, które można uzyskać przez porównawcze profilowanie fluxomu: wykryte anality i wybór znacznika izotopowego. Oprócz analitów na bazie polimerów, takich jak monitorowane tutaj aminokwasy proteinogenne, profile fluxomu można wykryć w dowolnym zestawie metabolitów wewnątrz- lub zewnątrzkomórkowych, tym samym rozszerzając obserwowalne procesy metaboliczne. Wybór znacznika zależy w pewnym stopniu od podsystem zainteresowania. Jednolicie oznakowane substraty zapewniają bardziej globalną perspektywę, ponieważ umożliwiają ocenę szyfrowania dowolnego szkieletu węglowego, a w przypadku eksperymentów przeprowadzanych na bogatych podłożach umożliwiają również ilościowe określenie frakcji de novo biosynteza ze znacznika w stosunku do pobierania składnika pożywki. Podobnie, podłoża deuterowane równomiernie lub 2 H2O są cenne do jednoczesnego przechwytywania dużej liczby układów scalonych, na które ma wpływ uwalnianie, wiązanie i wymiana wody lub protonów. Natomiast substraty, które są oznakowane w określonych pozycjach, umożliwiają głębsze badanie poszczególnych podsieci, na przykład heksoz [1-13C] dla początkowych reakcji katabolicznych [8, 19] lub [1-13C]asparaginian w celu oceny aktywność cyklu mocznikowego.

Wyniki ujawniły również nowe informacje biologiczne na temat aktywności, funkcji lub regulacji szlaku. Po pierwsze, zarówno glikoliza, jak i szlak pentozofosforanowy aktywnie katabolizował glukozę w obecności CAA, ponieważ pgi oraz yqjI sygnatury mutantów różniły się od typu dzikiego i od siebie nawzajem. Z kolei na sorbitolu te same mutanty były bardzo podobne do typu dzikiego, co sugeruje, że obie reakcje są tylko marginalnie zaangażowane w katabolizm tego cukru. Po drugie, przepływ cyklu Krebsa był podobny dla glukozy i sorbitolu (z CAA i bez), jak wywnioskowano z podobnie wyraźnych sygnatur sdhC mutant. Po trzecie, brak sdhC sygnatury w aminokwasach pochodzących z cyklu Krebsa, asparaginian i glutaminian mdh mutant rosnący z amonem (ale nie CAA) wskazuje na aktywność omijającego pirogronianu opartego na enzymie jabłczanowym [30]. Po czwarte, aktywność enzymu jabłczanowego zależnego od NADP wydaje się być niezależna od represji katabolicznej, ponieważ wyraźne sygnatury ytsJ mutant zaobserwowano na wszystkich podłożach. Przeciwnie, glukoneogenna syntetaza fosfoenolopirogronianowa Pps była nieaktywna w obecności hamującej glukozy, ale aktywna wobec pirogronianu lub sorbitolu. Po piąte, jak omówiono powyżej, dane ujawniają promujący cykl Krebsa wpływ represora CggR na sorbitol, ale nie na glukozę, najprawdopodobniej poprzez represję genów glikolitycznych [22].

Przedstawione tutaj porównawcze profilowanie fluxomu uzupełnia tradycyjną analizę strumienia, ponieważ umożliwia potencjalnie szybką i zautomatyzowaną identyfikację odpowiednich mutantów lub warunków z zestawów danych na dużą skalę, na przykład z całych bibliotek mutantów. Podejście jest ilościowe pod względem względnej różnicy między wariantami, ale jakościowe pod względem in vivo strumień. Ciekawe warianty są następnie poddawane głębszemu badaniu zidentyfikowanego specyficznego zjawiska metabolicznego. Oprócz samej eksploracji danych, profilowanie fluxomu ma również potencjał do identyfikowania złożonych cech funkcjonalnych w wyższych komórkach, w których obecne metody strumieniowe zawodzą, a być może nawet do zidentyfikowania podstawowego mechanizmu biochemicznego sygnatur dyskryminacyjnych izotopów masy.


Metody

Szczepy i plazmidy

E coli Do klonowania użyto DH10B. E coli BLR (DE3) i DH1 zastosowano do badań ekspresji z wektorami BglBrick. Plazmidy i części BglBrick użyte w tym badaniu wymieniono w Tabeli 1. Pożywki uzupełniono 100 μg/ml ampicyliny, 35 μg/ml chloramfenikolu lub 50 μg/ml kanamycyny w celu selekcji do utrzymywania plazmidu. Wszystkie szczepy hodowano w 30°C, chyba że opisano inaczej.

Budowa części wektorowych BglBrick

Skonstruowane tutaj plazmidy matrycowe lub części wektorów BglBrick wymieniono w Tabeli 1, a startery do amplifikacji PCR wymieniono w Tabeli 2. Każdy składnik genu został albo zamplifikowany metodą PCR z matrycy przy użyciu polimerazy DNA Phusion™ High-Fidelity (New England BioLabs, F-530) lub strawiono z plazmidów matrycowych i włączono do plazmidu wektorowego BglBrick standardową metodą trawienia restrykcyjnego/ligacji.

Początki replikacji

Początek p15A uzyskano z plazmidu pZA31-luc, początek ColE1 z plazmidu pZE12-luc, a początek pSC101* z plazmidu pZS*24-MCS1 [39]. A BglII miejsce w początku pSC101* zostało wyeliminowane przez ukierunkowaną mutagenezę. Oligonukleotydy użyte do usunięcia BglII miejscem pochodzenia pSC101* były pSC101QC F1 i pSC101QC R1 tworzące pSC101**. Każdy moduł początku replikacji i sekwencja terminatora został sklonowany przy użyciu AvrII oraz SacI witryny. Plazmid pMBIS zastosowano jako matrycę dla początku pBBR1. Region BBR1 amplifikowano w dwóch częściach, a startery zaprojektowano w celu dokonania mutacji punktowej C do T w nakładającym się regionie dwóch produktów PCR w celu zwiększenia liczby kopii, jak opisano [22]. Starter przedni pBBR1 F1 (5'- gatcaCCTAGGctacagccgatagtctggaacagcgc -3') i starter wsteczny pBBR1 mut R1 (5'- ccggcaccgtgtTggcctacgtggtc -3') zostały użyte do wygenerowania pierwszego produktu z 5'-AvrII do wygenerowania drugiego produktu z SpeI Strona. Te dwie części połączono następnie w reakcji sklejania nakładek-PCR (SOE-PCR) ze starterami pBBR1 F1 i pBBR1 R2 w celu wytworzenia produktu zawierającego całe miejsce startu replikacji pBBR1. Produkt PCR trawiono AvrII oraz SpeI i poddano ligacji z istniejącymi wektorami pośrednimi w celu wytworzenia trzech dodatkowych wektorów pośrednich zawierających pBBR1 i każdy moduł oporności na antybiotyk.

Odporność na antybiotyki

Wszystkie segmenty oporności na antybiotyki (SacI do AatII) trawiono z macierzystych plazmidów wymienionych w Tabeli 1. Miejsce restrykcyjne BglBrick znalezione w składnikach genów odporności Cm i Km usunięto przez mutagenezę specyficzną dla miejsca. Oligonukleotydy użyte do usunięcia EcoRI miejscem w genie odporności Cm były przednie CmQC F1 (5'-ctttcattgccatacgAaattccggatgagcattc-3') i odwrotne CmQC R1 (5'-gaatgctcatccggaattTcgtatggcaatgaaag-3') (mutacja punktowa jest pisana wielką literą). Oligonukleotydy użyte do usunięcia BglII miejscem w promotorze genu odporności Km były KanQC F1 (5'-cctgtctcttgatcagatcAtgatcccctgc-3') i KanQC R1 (5'-gcaggggatcaTgatctgatcaagagacagg-3').

Rfp (lub gfp) i terminator

Moduł rfp-terminator (rfp-term) został skonstruowany przez splice-over-over-PCR (SOE-PCR [47]. Najpierw wykonano SOE-PCR w celu wygenerowania rfp z witrynami z ograniczeniami BglBrick EcoRI oraz BglII i RBS (TTTAAGAAGGAGATATACAT) na końcu 5' oraz z miejscami restrykcyjnymi BglBrick BamHI oraz XhoI i sekwencja podwójnego terminatora, po której następuje AatII strona na końcu 3'. Przeprowadzono dwa PCR w celu amplifikacji rfp i terminator oddzielnie, stosując startery do wprowadzenia miejsc restrykcyjnych, RBS i nakładającej się sekwencji dla SOE-PCR. Starter przedni RFP F1 i starter wsteczny RFP R1 zostały użyte do wygenerowania produktu zawierającego EcoRI, BglII, RBS i rfp. Starter przedni Term F1 i starter wsteczny Term R1 zostały użyte do wytworzenia produktu zawierającego BamHI, XhoI, sekwencja podwójnego terminatora i AvrII. Produkty następnie połączono i przeprowadzono drugą reakcję PCR z RFP F1 i Term R1. Powstały produkt SOE-PCR (rfp-termin) został z kolei wykorzystany w dodatkowych SOE-PCR do wygenerowania kompletnych modułów zawierających 8 różnych systemów promotorowych, a następnie rfp-semestr.

Promotorzy i represorzy

Startery dla każdego systemu promotorowego (zawierającego represor i promotor) zostały zaprojektowane tak, aby zawierały 5'AatII miejsce na późniejsze kroki klonowania i rfp nakładająca się sekwencja na końcu 3', aby ułatwić dodanie rfp-moduł terminatora przez SOE-PCR. Gdy system promotorowy zawierał dowolne z 4 miejsc restrykcyjnych BglBrick, dla SOE-PCR przygotowano dodatkowy zestaw starterów do usunięcia miejsca restrykcyjnego. Startery dla każdego systemu promotorowego wymieniono w Tabeli 2.

Ostateczny montaż wektora pBb

Aby skonstruować system promotora z rfp-moduł terminatora, każdy z ośmiu modułów systemu promotora został połączony z rfp-terminator metodą SOE-PCR przy użyciu startera F1 z każdej konstrukcji systemu promotora i startera wstecznego Term R1. Te osiem produktów zostało następnie strawionych AatII oraz AvrII i indywidualnie ligowane z AatII oraz AvrII strawiony fragment plazmidu pośredniego zawierający wzmacniacz R i ColE1. Jedenaście pozostałych plazmidów pośrednich trawiono następnie AvrII oraz AatII do wyizolowania modułów pochodzenia replikacji oporności na antybiotyki (AR-ori). W sumie każdy z dwunastu modułów AR-ori został zligowany z każdym z ośmiu AvrII oraz AatII strawione moduły promotor-rfp-terminator w celu wytworzenia 96 unikalnych wektorów pBb.

Eksperymenty z arkuszem danych

Ogólny

Plazmidy pBb oporne na ampicylinę zostały przekształcone w E coli Ogniwa elektrokompetentne BLR(DE3) i/lub E coli Elektrokompetentne komórki DH1 i wysiane na agarze LB z 50 μg/ml karbenicyliny (Cb) do inkubacji przez noc w 37°C. Pobrano pojedynczą kolonię i użyto do przygotowania hodowli posiewowej w bulionie LB zawierającym 50 μg/ml Cb. Świeże probówki hodowlane z 3 ml bulionem LB zawierającym 50 μg/ml Cb zaszczepiono 60 μl całonocnej hodowli posiewowej i hodowano w 37°C, 200 obr./min do OD600 osiągnął około 0,55. Wszystkie eksperymenty powtórzono w trzech powtórzeniach.

Odpowiedź na dawkę induktora

Zewnętrzne studzienki 96-studzienkowej płytki z przezroczystym dnem z pokrywką (nr Corning: 3631) napełniono 200 µl sterylnej wody, a płytkę wysterylizowano przy użyciu optymalne usieciowanie ustawienie na środku sieciującym UV (Spectronics, Corp.). Wykonano 10 x seryjne rozcieńczenia induktorów odpowiednich dla każdego testowanego plazmidu i 20 μl odpipetowano do każdego dołka, tak aby końcowa objętość 200 μl dawała 1x stężenie induktora. Każda płytka zawierała 3 studzienki kontrolne zawierające pBbE5a-RFP (lub GFP) w BLR(DE3) indukowane 12,5 µM IPTG. Odpowiednie objętości hodowli i LB/Cb dodano do 96-studzienkowej płytki z pokrywką i hodowano w czytniku mikropłytek Safire (Tecan) w 30°C przez 20,5 godziny. OD600 a fluorescencję RFP mierzono co 570 sekund stosując długość fali wzbudzenia 584 nm i długość fali emisji 607 nm. W przypadku konstruktów zawierających GFP (plazmidy pBbB) do pomiaru fluorescencji zastosowano długość fali wzbudzenia 400 nm i długość fali emisji 510 nm.

Odkształcenie i średnie uzależnienie

E coli BLR(DE3) i DH1 transformowane plazmidem pBb posiano na agarze LB z 50 μg/ml Cb i hodowano w 37°C przez noc. Hodowle posiewowe przygotowano w bulionie LB zawierającym 50 μg/ml Cb zaszczepionego pojedynczą kolonią i hodowano w 37°C, 200 rpm przez noc. Każdy eksperyment ze szczepem zawierającym plazmid pBb powtórzono w trzech powtórzeniach, a każdy zestaw eksperymentów obejmował 6 probówek kontrolnych zawierających pBbE5a-RFP w BLR(DE3) w LB (3 nieindukowane i 3 indukowane 100 μM IPTG). W eksperymencie z pożywką minimalną (MM) M9 przeprowadzono trzy rundy adaptacji w pożywce minimalnej. Po adaptacji świeże probówki z 3 ml świeżego MM zaszczepiono hodowlą dostosowaną do OD600 około 0,15 i hodowane w 37°C do OD600 około 0,5.Jeden zestaw probówek indukowano przy różnych stężeniach induktora i wszystkie hodowle hodowano w 30°C, 200 rpm przez 66 godzin po indukcji. Próbki pobrano 18 godzin, 42 godziny i 66 godzin po indukcji. 25 µl hodowli umieszczono na 96-studzienkowej płytce i rozcieńczono do 200 µl świeżą pożywką i OD600 i zmierzono fluorescencję. W doświadczeniach z pożywkami LB i TB, nocne hodowle posiewowe stosowano bezpośrednio do zaszczepiania bez adaptacji.

Represja kataboliczna i przesłuch induktorów

Hodowle posiewowe przygotowano w sposób opisany w doświadczeniach z zależnością od szczepów i pożywek. Do eksperymentów represji katabolicznej zastosowano trzy różne podłoża (MM, LB buforowany fosforanem i TB buforowany fosforanem) zawierające 1% glukozy. Zaszczepione kultury rosły w 37°C do OD600 około 0,5 i indukowane do osiągnięcia maksymalnej ekspresji (100 μM IPTG, 20 mM arabinoza, 400 nM aTc lub 20 mM propionian). Kultury hodowano w 30°C, 200 obr./min przez 66 godzin po indukcji i OD600 a fluorescencję mierzono przy każdym próbkowaniu. W doświadczeniu z induktorem przesłuchu, bulion LB zawierający 50 μg/ml Cb zaszczepiono kulturami nasion zawierającymi E coli BLR(DE3) niosący pBb oporny na ampicylinę. Hodowle indukowano przy OD600 około 0,5 z odpowiednim induktorem, a jeden z niespokrewnionych induktorów był również dodawany do indywidualnie indukowanej hodowli podczas indukcji. Kultury hodowano w 30°C, 200 obr./min przez 18 godzin po indukcji i OD600 a fluorescencję mierzono za pomocą Tecan.

Izolacja bakteryjnego DNA w celu ilościowego określenia liczby kopii plazmidu

E coli DH1 i BLR hodowano przez noc w 30°C, wytrząsając 200 rpm po zaszczepieniu 5 ml hodowli pożywki LB (uzupełnionej 50 μg/ml kanamycyny) pojedynczymi koloniami ze świeżo posianych płytek. Po hodowli następczej (1:50) w kolbach do wytrząsania zawierających 50 ml pożywki LB (uzupełnionej 50 μg/ml kanamycyny), komórki hodowano w 30°C, wytrząsając 200 obr./min aż do uzyskania OD600 osiągnięto 0,3-0,4. W tym czasie odwirowano 1 ml komórek, a następnie usunięto supernatant. Następnie osady komórkowe zamrożono. Z tych osadów wyizolowano całkowite DNA do wykorzystania w przyszłości. Przyjęto metodę izolacji DNA opisaną we wcześniejszych publikacjach [33, 48]. Osady komórek bakteryjnych ponownie zawieszono w 400 µl 50 mM Tris/50 mM EDTA, pH 8, przez worteksowanie. Błony komórkowe permeabilizowano przez dodanie 8 µl 50 mg/ml lizozymu (Sigma) w 10 mM Tris/1 mM EDTA, pH 8, a następnie inkubację w 37°C przez 30 min. Aby zakończyć lizę komórek, do każdej probówki dodano 4 µl 10% SDS i 8 µl 20 mg/ml roztworu proteinazy K (Invitrogen), zmieszano strzykawką z igłą o rozmiarze 21, 1,5 cala i inkubowano w 50° C przez 30 min. Proteinazę K następnie inaktywowano termicznie w 75°C przez 10 min, a RNA trawiono przez dodanie 2 µl 100 mg/ml roztworu RNazy A (Qiagen), a następnie inkubowano w 37°C przez 30 min. Następnie przeprowadzono całkowitą ekstrakcję DNA przez dodanie 425 µl 25:24:1 fenol:chloroform:alkohol izoamylowy, energicznie worteksując

1 min, pozostawienie probówek w temperaturze pokojowej na kilka minut, a następnie odwirowanie przez 5 min przy 14 000 × g, 4°C. Następnie 300 µl górnej fazy wodnej przeniesiono do nowej probówki za pomocą szeroko otwierającej się końcówki pipety. Ekstrakcję DNA kontynuowano przez dodanie 400 μl chloroformu do każdej probówki, energicznie worteksując przez

1 min, pozostawienie probówek w temperaturze pokojowej na kilka minut i odwirowanie przez 5 min przy 14 000 × g, 4°C. Następnie 200 µl górnej fazy wodnej przeniesiono do nowej probówki za pomocą szeroko otwierającej się końcówki pipety. Po ekstrakcji chloroformem, całkowite DNA wytrącano etanolem przez noc, przemywano 70% etanolem, a na koniec ponownie zawieszono w 40 µl wody wolnej od nukleaz. Stężenie i czystość DNA oznaczono za pomocą spektrofotometru Nanodrop, a integralność zbadano na 1% żelach agarozowych.

Kwantyfikacja qPCR w czasie rzeczywistym liczby kopii plazmidu

Zestawy starterów specyficzne dla fosfotransferazy neomycyny II (nptII) do qPCR w czasie rzeczywistym wykorzystano gen (forward: GCGTTGGCTACCCGTGATAT, rewers: AGGAAGCGGTCAGCCCAT) [49] oraz 16S rDNA (forward: CCGGATTGGAGTCTGCAACT, rewers: GTGGCATTCTGATCCACGATTAC) [33]. Startery te amplifikowały pojedynczy produkt o oczekiwanej wielkości, co potwierdzają temperatury topnienia amplikonów. nptII znajduje się w pojedynczej kopii na plazmidach scharakteryzowanych w tym badaniu, podczas gdy gen 16S rDNA znajduje się w wielu kopiach na E coli chromosomu [36] i został wykorzystany do normalizacji [22, 33, 35]. W celu określenia liczby kopii plazmidu (tj. liczby plazmidów na ekwiwalent genomowy), E coli Transgeniczne szczepy DH1 i BLR z pojedynczym nptII całkowanie (dane niepokazane) zastosowano do kalibracji. Całkowite DNA wyizolowane z każdego szczepu zostało najpierw strawione przez noc przy użyciu EcoR I (New England Biolabs) w 37°C. qPCR w czasie rzeczywistym przeprowadzono na BioRad iCycler z 96-dołkowymi blokami reakcyjnymi w obecności SYBR Green w następujących warunkach: 1X iQ SYBR Green Supermix (BioRad), 150 nM nptII (500 nM 16S) starterów w reakcji 25 µl. Cykl qPCR w czasie rzeczywistym wynosił 95°C przez 3 min, a następnie 40 cykli po 30 s w 95°C, 30 s w 60°C i 30 s w 72°C. Cykle progowe (Ct) wyznaczono za pomocą oprogramowania iCycler (BioRad) dla wszystkich próbek. Do oceny ilościowej przygotowano krzywą standardową. W tym celu z strawionej próbki całkowitego DNA przygotowano serię czterokrotnych rozcieńczeń w sumie siedmiu rozcieńczeń, a każde rozcieńczenie poddano analizie qPCR w co najmniej dwóch nptII- lub startery specyficzne dla 16S. Uzyskane wartości Ct zostały wykorzystane przez pakiet oprogramowania iCycler do wykreślenia krzywej standardowej, która umożliwiła ilościowe określenie nptII lub 16S w strawionych próbkach całkowitego DNA (tj. nieznane) w stosunku do próbki DNA użytej do przygotowania krzywej standardowej.

Kontrola ekspresji w układzie trójplazmidowym

Komórki BLR (DE3) transformowano trzema plazmidami: pBbA8a-CFP, pBbE5c-YFP i pBbS2k-RFP. Do zaszczepienia pożywki LB użyto pojedynczej kolonii, a hodowle przez noc hodowano w 37°C na pożywce minimalnej (pożywka M9 dostarczona z 75 mM MOPS, 2 mM MgSO4, 1 mg/L tiaminy, 10 nM FeSO4, 0,1 mM CaCl22 i mikroelementów) z dodatkiem 2% glukozy. Komórki indukowano przy OD

0,6 z kombinacjami różnych ilości arabinozy, IPTG i aTc. W szczególności, zastosowane stężenia arabinozy wynosiły 0, 5 mM i 20 mM, zastosowane stężenia IPTG wynosiły 0, 30 µM i 100 µM, a zastosowane stężenia aTc wynosiły 0, 12,5 nM, 25 nM i 40 nM. Po indukcji komórki hodowano w 30°C przez 12 godzin, aż zmierzono fluorescencję hodowli komórkowej. Fluorescencję hodowli komórkowej rejestrowano na czytniku płytek SpectraMax M2 (Molecular Devices) stosując 96-studzienkowe płytki Costar, przy czym każda studzienka zawierała 150 µl hodowli komórkowej. W przypadku WPRyb, λbyły = 433 nm i λem = 474 nm zastosowano dla YFP, λbyły = 500 nm i λem = 530 nm, a dla RFP λbyły = 584 nm i λem = 615 nm. Gęstość komórek oszacowano mierząc absorbancję przy 610 nm. Fluorescencję hodowli komórkowej z każdego dołka znormalizowano na podstawie gęstości komórek. Wszystkie dane były średnią z co najmniej dwóch niezależnych pomiarów.


Obejrzyj wideo: Expocición de Biología (Czerwiec 2022).


Uwagi:

  1. Octa

    Pytanie jest inną odpowiedzią

  2. Avshalom

    I moved away from this sentence

  3. Deogol

    Moim zdaniem nie masz racji. Zapewniam. Porozmawiajmy o tym. Napisz do mnie na PW.

  4. Barr

    zrozumiała wiadomość

  5. Wyligby

    Łatwiej jest uderzyć głową o ścianę niż zaimplementować to wszystko w normalnej formie

  6. Forba

    wspaniałe zdanie i jest terminowe

  7. Alhmanic

    Mylisz się. Proponuję to omówić. Napisz do mnie na PM, porozmawiamy.



Napisać wiadomość